ID: 1007631412

View in Genome Browser
Species Human (GRCh38)
Location 6:43275370-43275392
Sequence CGAAAACGGGCGCGAAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 15}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631412_1007631426 26 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631426 6:43275419-43275441 GGCCTTTGGGTCCCTGGCCCCGG No data
1007631412_1007631419 2 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631412_1007631423 12 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631412_1007631427 27 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631427 6:43275420-43275442 GCCTTTGGGTCCCTGGCCCCGGG 0: 1
1: 0
2: 4
3: 48
4: 305
1007631412_1007631420 5 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631420 6:43275398-43275420 TTTTCCCTGCTGCTGGCTGGCGG 0: 1
1: 0
2: 1
3: 47
4: 374
1007631412_1007631424 13 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631424 6:43275406-43275428 GCTGCTGGCTGGCGGCCTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 181
1007631412_1007631429 28 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631429 6:43275421-43275443 CCTTTGGGTCCCTGGCCCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 187
1007631412_1007631425 20 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631425 6:43275413-43275435 GCTGGCGGCCTTTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 196
1007631412_1007631418 -2 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631418 6:43275391-43275413 CGTTTGCTTTTCCCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631412 Original CRISPR CGAAAACGGGCGCGAAGGCG GGG (reversed) Intronic