ID: 1007631413

View in Genome Browser
Species Human (GRCh38)
Location 6:43275371-43275393
Sequence ACGAAAACGGGCGCGAAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 20}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631413_1007631430 30 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data
1007631413_1007631423 11 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631413_1007631425 19 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631425 6:43275413-43275435 GCTGGCGGCCTTTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 196
1007631413_1007631419 1 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631413_1007631427 26 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631427 6:43275420-43275442 GCCTTTGGGTCCCTGGCCCCGGG 0: 1
1: 0
2: 4
3: 48
4: 305
1007631413_1007631420 4 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631420 6:43275398-43275420 TTTTCCCTGCTGCTGGCTGGCGG 0: 1
1: 0
2: 1
3: 47
4: 374
1007631413_1007631424 12 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631424 6:43275406-43275428 GCTGCTGGCTGGCGGCCTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 181
1007631413_1007631429 27 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631429 6:43275421-43275443 CCTTTGGGTCCCTGGCCCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 187
1007631413_1007631426 25 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631426 6:43275419-43275441 GGCCTTTGGGTCCCTGGCCCCGG No data
1007631413_1007631418 -3 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631418 6:43275391-43275413 CGTTTGCTTTTCCCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631413 Original CRISPR ACGAAAACGGGCGCGAAGGC GGG (reversed) Intronic