ID: 1007631415

View in Genome Browser
Species Human (GRCh38)
Location 6:43275375-43275397
Sequence GCAAACGAAAACGGGCGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631415_1007631427 22 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631427 6:43275420-43275442 GCCTTTGGGTCCCTGGCCCCGGG 0: 1
1: 0
2: 4
3: 48
4: 305
1007631415_1007631430 26 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data
1007631415_1007631423 7 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631415_1007631433 29 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631433 6:43275427-43275449 GGTCCCTGGCCCCGGGGCGGGGG No data
1007631415_1007631431 27 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631431 6:43275425-43275447 TGGGTCCCTGGCCCCGGGGCGGG 0: 1
1: 1
2: 3
3: 72
4: 485
1007631415_1007631420 0 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631420 6:43275398-43275420 TTTTCCCTGCTGCTGGCTGGCGG 0: 1
1: 0
2: 1
3: 47
4: 374
1007631415_1007631419 -3 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631415_1007631432 28 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631432 6:43275426-43275448 GGGTCCCTGGCCCCGGGGCGGGG 0: 1
1: 0
2: 2
3: 43
4: 440
1007631415_1007631426 21 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631426 6:43275419-43275441 GGCCTTTGGGTCCCTGGCCCCGG No data
1007631415_1007631418 -7 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631418 6:43275391-43275413 CGTTTGCTTTTCCCTGCTGCTGG No data
1007631415_1007631429 23 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631429 6:43275421-43275443 CCTTTGGGTCCCTGGCCCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 187
1007631415_1007631425 15 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631425 6:43275413-43275435 GCTGGCGGCCTTTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 196
1007631415_1007631424 8 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631424 6:43275406-43275428 GCTGCTGGCTGGCGGCCTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631415 Original CRISPR GCAAACGAAAACGGGCGCGA AGG (reversed) Intronic