ID: 1007631416

View in Genome Browser
Species Human (GRCh38)
Location 6:43275383-43275405
Sequence AGGGAAAAGCAAACGAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 523}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631416_1007631429 15 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631429 6:43275421-43275443 CCTTTGGGTCCCTGGCCCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 187
1007631416_1007631426 13 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631426 6:43275419-43275441 GGCCTTTGGGTCCCTGGCCCCGG No data
1007631416_1007631425 7 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631425 6:43275413-43275435 GCTGGCGGCCTTTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 196
1007631416_1007631435 24 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631435 6:43275430-43275452 CCCTGGCCCCGGGGCGGGGGCGG 0: 1
1: 0
2: 6
3: 138
4: 868
1007631416_1007631424 0 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631424 6:43275406-43275428 GCTGCTGGCTGGCGGCCTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 181
1007631416_1007631423 -1 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631416_1007631420 -8 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631420 6:43275398-43275420 TTTTCCCTGCTGCTGGCTGGCGG 0: 1
1: 0
2: 1
3: 47
4: 374
1007631416_1007631437 25 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631437 6:43275431-43275453 CCTGGCCCCGGGGCGGGGGCGGG No data
1007631416_1007631427 14 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631427 6:43275420-43275442 GCCTTTGGGTCCCTGGCCCCGGG 0: 1
1: 0
2: 4
3: 48
4: 305
1007631416_1007631430 18 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data
1007631416_1007631431 19 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631431 6:43275425-43275447 TGGGTCCCTGGCCCCGGGGCGGG 0: 1
1: 1
2: 3
3: 72
4: 485
1007631416_1007631433 21 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631433 6:43275427-43275449 GGTCCCTGGCCCCGGGGCGGGGG No data
1007631416_1007631432 20 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631432 6:43275426-43275448 GGGTCCCTGGCCCCGGGGCGGGG 0: 1
1: 0
2: 2
3: 43
4: 440
1007631416_1007631438 29 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631438 6:43275435-43275457 GCCCCGGGGCGGGGGCGGGCTGG 0: 1
1: 1
2: 23
3: 256
4: 1663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631416 Original CRISPR AGGGAAAAGCAAACGAAAAC GGG (reversed) Intronic