ID: 1007631419

View in Genome Browser
Species Human (GRCh38)
Location 6:43275395-43275417
Sequence TGCTTTTCCCTGCTGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 285}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631415_1007631419 -3 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631414_1007631419 0 Left 1007631414 6:43275372-43275394 CCGCCTTCGCGCCCGTTTTCGTT 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631406_1007631419 17 Left 1007631406 6:43275355-43275377 CCGCCGCCCCCGTCGCCCCGCCT 0: 1
1: 1
2: 6
3: 141
4: 1236
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631410_1007631419 9 Left 1007631410 6:43275363-43275385 CCCGTCGCCCCGCCTTCGCGCCC No data
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631408_1007631419 11 Left 1007631408 6:43275361-43275383 CCCCCGTCGCCCCGCCTTCGCGC No data
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631409_1007631419 10 Left 1007631409 6:43275362-43275384 CCCCGTCGCCCCGCCTTCGCGCC 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631412_1007631419 2 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631403_1007631419 20 Left 1007631403 6:43275352-43275374 CCCCCGCCGCCCCCGTCGCCCCG No data
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631407_1007631419 14 Left 1007631407 6:43275358-43275380 CCGCCCCCGTCGCCCCGCCTTCG No data
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631405_1007631419 18 Left 1007631405 6:43275354-43275376 CCCGCCGCCCCCGTCGCCCCGCC No data
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631404_1007631419 19 Left 1007631404 6:43275353-43275375 CCCCGCCGCCCCCGTCGCCCCGC No data
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631411_1007631419 8 Left 1007631411 6:43275364-43275386 CCGTCGCCCCGCCTTCGCGCCCG 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631413_1007631419 1 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631419 Original CRISPR TGCTTTTCCCTGCTGCTGGC TGG Intronic