ID: 1007631421

View in Genome Browser
Species Human (GRCh38)
Location 6:43275402-43275424
Sequence AAGGCCGCCAGCCAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 248}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631421_1007631442 15 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631442 6:43275440-43275462 GGGGCGGGGGCGGGCTGGAGTGG 0: 1
1: 3
2: 30
3: 327
4: 2584
1007631421_1007631435 5 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631435 6:43275430-43275452 CCCTGGCCCCGGGGCGGGGGCGG 0: 1
1: 0
2: 6
3: 138
4: 868
1007631421_1007631443 16 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631443 6:43275441-43275463 GGGCGGGGGCGGGCTGGAGTGGG No data
1007631421_1007631430 -1 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data
1007631421_1007631427 -5 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631427 6:43275420-43275442 GCCTTTGGGTCCCTGGCCCCGGG 0: 1
1: 0
2: 4
3: 48
4: 305
1007631421_1007631437 6 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631437 6:43275431-43275453 CCTGGCCCCGGGGCGGGGGCGGG No data
1007631421_1007631432 1 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631432 6:43275426-43275448 GGGTCCCTGGCCCCGGGGCGGGG 0: 1
1: 0
2: 2
3: 43
4: 440
1007631421_1007631433 2 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631433 6:43275427-43275449 GGTCCCTGGCCCCGGGGCGGGGG No data
1007631421_1007631438 10 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631438 6:43275435-43275457 GCCCCGGGGCGGGGGCGGGCTGG 0: 1
1: 1
2: 23
3: 256
4: 1663
1007631421_1007631426 -6 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631426 6:43275419-43275441 GGCCTTTGGGTCCCTGGCCCCGG No data
1007631421_1007631431 0 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631431 6:43275425-43275447 TGGGTCCCTGGCCCCGGGGCGGG 0: 1
1: 1
2: 3
3: 72
4: 485
1007631421_1007631444 17 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631444 6:43275442-43275464 GGCGGGGGCGGGCTGGAGTGGGG 0: 1
1: 0
2: 8
3: 133
4: 1213
1007631421_1007631429 -4 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631429 6:43275421-43275443 CCTTTGGGTCCCTGGCCCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631421 Original CRISPR AAGGCCGCCAGCCAGCAGCA GGG (reversed) Intronic