ID: 1007631423

View in Genome Browser
Species Human (GRCh38)
Location 6:43275405-43275427
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 243}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631417_1007631423 -2 Left 1007631417 6:43275384-43275406 CCGTTTTCGTTTGCTTTTCCCTG 0: 1
1: 0
2: 1
3: 54
4: 669
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631403_1007631423 30 Left 1007631403 6:43275352-43275374 CCCCCGCCGCCCCCGTCGCCCCG No data
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631412_1007631423 12 Left 1007631412 6:43275370-43275392 CCCCGCCTTCGCGCCCGTTTTCG 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631415_1007631423 7 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631409_1007631423 20 Left 1007631409 6:43275362-43275384 CCCCGTCGCCCCGCCTTCGCGCC 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631410_1007631423 19 Left 1007631410 6:43275363-43275385 CCCGTCGCCCCGCCTTCGCGCCC No data
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631405_1007631423 28 Left 1007631405 6:43275354-43275376 CCCGCCGCCCCCGTCGCCCCGCC No data
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631413_1007631423 11 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631404_1007631423 29 Left 1007631404 6:43275353-43275375 CCCCGCCGCCCCCGTCGCCCCGC No data
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631408_1007631423 21 Left 1007631408 6:43275361-43275383 CCCCCGTCGCCCCGCCTTCGCGC No data
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631411_1007631423 18 Left 1007631411 6:43275364-43275386 CCGTCGCCCCGCCTTCGCGCCCG 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631406_1007631423 27 Left 1007631406 6:43275355-43275377 CCGCCGCCCCCGTCGCCCCGCCT 0: 1
1: 1
2: 6
3: 141
4: 1236
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631407_1007631423 24 Left 1007631407 6:43275358-43275380 CCGCCCCCGTCGCCCCGCCTTCG No data
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631416_1007631423 -1 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631414_1007631423 10 Left 1007631414 6:43275372-43275394 CCGCCTTCGCGCCCGTTTTCGTT 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type