ID: 1007631430

View in Genome Browser
Species Human (GRCh38)
Location 6:43275424-43275446
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631421_1007631430 -1 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data
1007631415_1007631430 26 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data
1007631417_1007631430 17 Left 1007631417 6:43275384-43275406 CCGTTTTCGTTTGCTTTTCCCTG 0: 1
1: 0
2: 1
3: 54
4: 669
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data
1007631416_1007631430 18 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data
1007631414_1007631430 29 Left 1007631414 6:43275372-43275394 CCGCCTTCGCGCCCGTTTTCGTT 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data
1007631413_1007631430 30 Left 1007631413 6:43275371-43275393 CCCGCCTTCGCGCCCGTTTTCGT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data
1007631422_1007631430 -2 Left 1007631422 6:43275403-43275425 CCTGCTGCTGGCTGGCGGCCTTT 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr