ID: 1007631431

View in Genome Browser
Species Human (GRCh38)
Location 6:43275425-43275447
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 1, 2: 3, 3: 72, 4: 485}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631415_1007631431 27 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631431 6:43275425-43275447 TGGGTCCCTGGCCCCGGGGCGGG 0: 1
1: 1
2: 3
3: 72
4: 485
1007631421_1007631431 0 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631431 6:43275425-43275447 TGGGTCCCTGGCCCCGGGGCGGG 0: 1
1: 1
2: 3
3: 72
4: 485
1007631416_1007631431 19 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631431 6:43275425-43275447 TGGGTCCCTGGCCCCGGGGCGGG 0: 1
1: 1
2: 3
3: 72
4: 485
1007631417_1007631431 18 Left 1007631417 6:43275384-43275406 CCGTTTTCGTTTGCTTTTCCCTG 0: 1
1: 0
2: 1
3: 54
4: 669
Right 1007631431 6:43275425-43275447 TGGGTCCCTGGCCCCGGGGCGGG 0: 1
1: 1
2: 3
3: 72
4: 485
1007631422_1007631431 -1 Left 1007631422 6:43275403-43275425 CCTGCTGCTGGCTGGCGGCCTTT No data
Right 1007631431 6:43275425-43275447 TGGGTCCCTGGCCCCGGGGCGGG 0: 1
1: 1
2: 3
3: 72
4: 485
1007631414_1007631431 30 Left 1007631414 6:43275372-43275394 CCGCCTTCGCGCCCGTTTTCGTT 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1007631431 6:43275425-43275447 TGGGTCCCTGGCCCCGGGGCGGG 0: 1
1: 1
2: 3
3: 72
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type