ID: 1007631432

View in Genome Browser
Species Human (GRCh38)
Location 6:43275426-43275448
Sequence GGGTCCCTGGCCCCGGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 440}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631415_1007631432 28 Left 1007631415 6:43275375-43275397 CCTTCGCGCCCGTTTTCGTTTGC No data
Right 1007631432 6:43275426-43275448 GGGTCCCTGGCCCCGGGGCGGGG 0: 1
1: 0
2: 2
3: 43
4: 440
1007631416_1007631432 20 Left 1007631416 6:43275383-43275405 CCCGTTTTCGTTTGCTTTTCCCT 0: 1
1: 0
2: 4
3: 46
4: 523
Right 1007631432 6:43275426-43275448 GGGTCCCTGGCCCCGGGGCGGGG 0: 1
1: 0
2: 2
3: 43
4: 440
1007631422_1007631432 0 Left 1007631422 6:43275403-43275425 CCTGCTGCTGGCTGGCGGCCTTT No data
Right 1007631432 6:43275426-43275448 GGGTCCCTGGCCCCGGGGCGGGG 0: 1
1: 0
2: 2
3: 43
4: 440
1007631421_1007631432 1 Left 1007631421 6:43275402-43275424 CCCTGCTGCTGGCTGGCGGCCTT 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1007631432 6:43275426-43275448 GGGTCCCTGGCCCCGGGGCGGGG 0: 1
1: 0
2: 2
3: 43
4: 440
1007631417_1007631432 19 Left 1007631417 6:43275384-43275406 CCGTTTTCGTTTGCTTTTCCCTG 0: 1
1: 0
2: 1
3: 54
4: 669
Right 1007631432 6:43275426-43275448 GGGTCCCTGGCCCCGGGGCGGGG 0: 1
1: 0
2: 2
3: 43
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631432 Original CRISPR GGGTCCCTGGCCCCGGGGCG GGG Intronic