ID: 1007631474

View in Genome Browser
Species Human (GRCh38)
Location 6:43275557-43275579
Sequence GCAGTGAGGTAACGGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631474_1007631494 25 Left 1007631474 6:43275557-43275579 CCTGACTCCCGTTACCTCACTGC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1007631494 6:43275605-43275627 CCAATAATTGGCCTTGCAATTGG 0: 1
1: 0
2: 0
3: 2
4: 86
1007631474_1007631485 13 Left 1007631474 6:43275557-43275579 CCTGACTCCCGTTACCTCACTGC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1007631485 6:43275593-43275615 CCCCACCCCGCCCCAATAATTGG 0: 1
1: 0
2: 2
3: 26
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631474 Original CRISPR GCAGTGAGGTAACGGGAGTC AGG (reversed) Intronic
902350038 1:15847673-15847695 GCAGTGCGGCGGCGGGAGTCGGG + Intergenic
903071175 1:20727611-20727633 GCAGTGGGGTGAAGGGAGTAAGG + Intronic
903288340 1:22291046-22291068 GAAGAGAGGTGAGGGGAGTCGGG - Intergenic
907430348 1:54407370-54407392 GGAGTGAGGGGACGAGAGTCAGG + Intronic
911582457 1:99650013-99650035 GAAGTGAAATAAGGGGAGTCTGG + Intronic
916058715 1:161084915-161084937 GCTGTCAGGTAAGGGGAGGCAGG - Intronic
916791474 1:168129139-168129161 GCAGAGAGGGAATGGGTGTCTGG + Intronic
916821663 1:168404633-168404655 GCTGTGAGGTAATGGGAGACAGG + Intergenic
917307742 1:173643920-173643942 GAACGGAGGTAAAGGGAGTCTGG - Intronic
919915367 1:202135599-202135621 GCAGAGAGGAAACGGGACCCAGG - Intronic
920038396 1:203080503-203080525 GCAGTGAGGGGCAGGGAGTCTGG + Intergenic
922720237 1:227896546-227896568 GCAGTCAGGGAAGGGGAGCCAGG + Intergenic
1063384273 10:5606371-5606393 GCAGTGAGGTTCCAGGAGCCTGG - Intergenic
1064619344 10:17199279-17199301 GCAGAGAGGTACAGGGAGGCAGG + Intronic
1065736852 10:28761183-28761205 GCACTGAGCTAGCAGGAGTCTGG - Intergenic
1066134894 10:32435366-32435388 GCAGTGGGGTCACTTGAGTCTGG + Intergenic
1066514875 10:36147064-36147086 TCAGTGATGTAAGGGGAGTGTGG + Intergenic
1067272467 10:44804239-44804261 GCAGTGGGGAGAGGGGAGTCTGG + Intergenic
1069789276 10:71009335-71009357 GCAGTGAAGTAATGGGATCCGGG - Intergenic
1075667342 10:124240602-124240624 GCACTGAGGTAAAGGGGGGCAGG - Intergenic
1077897383 11:6463680-6463702 GGAGTGGGGTAACGGGAGCCAGG + Intronic
1078672347 11:13376603-13376625 GCAATAAGGAAACGTGAGTCAGG - Intronic
1079606047 11:22367801-22367823 GCAGTGAGGTATAGGAAGTGGGG - Intronic
1083997487 11:66279358-66279380 GTAGTGAGGGGACGGGAGCCAGG - Intronic
1084603978 11:70162084-70162106 GCAGTGAGGACCCGGGAGTGAGG + Intronic
1084603997 11:70162146-70162168 GCAGTGAGGACCCGGGAGTGAGG + Intronic
1084849750 11:71929177-71929199 GCAGTGAGGTATCGGGAGGTGGG + Intronic
1084974528 11:72789573-72789595 GCAGTGAGGCACAGGGGGTCTGG + Intronic
1091708024 12:2713186-2713208 GCAGAGAGGTAGATGGAGTCAGG - Intergenic
1100730151 12:97456980-97457002 GCAGTCAGGTCTCGGGACTCAGG + Intergenic
1102105294 12:110316188-110316210 GCAGTTATGTAAATGGAGTCTGG + Intronic
1109564240 13:64090411-64090433 GGAGTCATGTAACCGGAGTCTGG + Intergenic
1112031718 13:95462590-95462612 GAAGTGAGGAAAAAGGAGTCAGG + Intronic
1113276123 13:108732565-108732587 GCAGTGAAGTGACAGGGGTCAGG + Intronic
1122133718 14:99620621-99620643 GCAGTGAGGGAAAGGGGGACAGG + Intergenic
1122834389 14:104423868-104423890 GTAGTGGGGTAACGGGGGCCTGG - Intergenic
1127963500 15:63907383-63907405 GCAGTGAGGTAGAGGGAGCATGG + Exonic
1128548563 15:68583488-68583510 GCAGTGGGGTAAGTGGAGTGGGG - Intronic
1128670867 15:69573861-69573883 GCAGCGAGGTAGGGGGAGCCAGG + Intergenic
1131069860 15:89459516-89459538 GCAGGGTGGTATTGGGAGTCAGG - Intergenic
1202983573 15_KI270727v1_random:389920-389942 ACAGAGAGGTTACTGGAGTCTGG + Intergenic
1136383980 16:29911390-29911412 CCAGTGAGGGACCGGGAGCCAGG + Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138582752 16:57952291-57952313 GCACTGGGAAAACGGGAGTCAGG - Intronic
1140998885 16:80289268-80289290 GCAGTGAGGAGACAGGAGTGGGG - Intergenic
1143816613 17:9521237-9521259 GGTGGGAGGTAACAGGAGTCTGG + Intronic
1144533320 17:16061832-16061854 GCAGTGTTGTAACGGGAGGCTGG + Exonic
1144847227 17:18226172-18226194 GCAGAGAGATAAAGGGAGACAGG - Intronic
1146921441 17:36715317-36715339 GCAGGGAGGTACTGGGAGTTCGG + Intergenic
1147577441 17:41610902-41610924 GCAGTGAGGTGACGGAGCTCCGG - Exonic
1149964978 17:61153129-61153151 AAAGTGAGGTAATGGGAGACAGG - Intronic
1151669618 17:75564915-75564937 GCAGTGAGGCTAAGGGACTCAGG - Intronic
1153699543 18:7678500-7678522 GCCCTGAGGGAACGGGAGGCCGG + Intronic
1160330686 18:77988613-77988635 GGAGTGAGGGAAGGGGAGGCTGG + Intergenic
1162530271 19:11231895-11231917 GCAGTGAGGTTATGGGTGACTGG + Intronic
1165657679 19:37548690-37548712 GCACTGAGGTCACGACAGTCAGG + Intronic
1166046975 19:40235541-40235563 GCAGTGAGGACACGTGGGTCCGG - Intronic
1166565938 19:43765550-43765572 GCAGTGGGGTAACGAGGGTCAGG + Intergenic
925991802 2:9260385-9260407 GCAGTGAGGTGATGGGAGAGGGG - Intronic
928455227 2:31414685-31414707 GGAGTGAGGTACCTGGAGTTCGG - Exonic
928955290 2:36860305-36860327 GCAGAGAGGTAAAGGAAGTAAGG + Intronic
929299516 2:40287378-40287400 TCAGTGATGTAATAGGAGTCAGG + Intronic
934527358 2:95059967-95059989 GCAGTGGAGTATCGGGAGTGGGG - Intergenic
935292993 2:101625604-101625626 GCAGTGGGGTACAGGGAGCCAGG - Intergenic
935328879 2:101961980-101962002 GGAGGGAGGAGACGGGAGTCAGG + Intergenic
942545739 2:177061975-177061997 GCAGTGAGTGAAGGGGAGTGAGG - Intergenic
946677541 2:222177842-222177864 GCACTGAGGTAGAGGGTGTCTGG + Intergenic
947169988 2:227301028-227301050 GGAGTCAGGTAACGGAGGTCTGG + Intronic
947729880 2:232421767-232421789 ACAGTGAGGGAACTGGAGCCTGG - Intergenic
1169136260 20:3199683-3199705 GCAGAGAGGTGATGGGGGTCTGG - Intronic
1171970169 20:31559543-31559565 GCAGTGAACTAACAGGAGACTGG - Intronic
1172808708 20:37631962-37631984 GCAGGGAGGTAAGGAGAGTGAGG + Intergenic
1175687626 20:61043199-61043221 GCAGTGAGTTTATGTGAGTCAGG - Intergenic
1181902581 22:26168804-26168826 GCAGTGGGGTTATGGGAGACAGG + Intergenic
1182650327 22:31846477-31846499 GAAGTGAGGTCACTGGAGTTTGG + Intronic
1185085962 22:48741206-48741228 GCAGTGTGGGAACGGGGGGCAGG - Intronic
950864121 3:16175400-16175422 GCAGTGAGATAAAGGGTGGCAGG - Exonic
953067996 3:39492306-39492328 GCAGTGAGGGAAGGGGTGGCTGG - Intronic
953194660 3:40721060-40721082 GCAGAGAGGGAACTGGAGTCTGG - Intergenic
953442252 3:42928365-42928387 GCAGGGAGGTAAGGGAGGTCAGG + Intronic
954403797 3:50333892-50333914 GCAGTGGGGCCAAGGGAGTCTGG - Intronic
954755230 3:52835590-52835612 AAAGTGAGGTAAAGGGAGCCTGG + Exonic
961808277 3:129504838-129504860 GCAGGGAGGTAATGTGAGCCAGG + Intronic
971489397 4:27195185-27195207 GCAGTGAGGTATGAGGAGTCAGG + Intergenic
975662119 4:76698564-76698586 CGAGTGAGGTAAAGGGACTCTGG - Intronic
977867887 4:102051678-102051700 GCAGAGAGGTAGCTGGGGTCAGG - Intronic
984470719 4:180169688-180169710 GAAGTGAGGGAAAGGGAGTGAGG - Intergenic
986510844 5:8504820-8504842 GCAGTGAGTTGGGGGGAGTCGGG + Intergenic
991220704 5:64212273-64212295 GAAGAGAGGTAATGGGAGTGAGG - Intronic
992205627 5:74427813-74427835 GCAGTGGGTTAAGGGGAGTAAGG + Intergenic
994086340 5:95763264-95763286 GCAGAGAGGTAGCAGCAGTCTGG + Intronic
996838679 5:127822636-127822658 GCAGTGATGTTCAGGGAGTCAGG + Intergenic
997362262 5:133302627-133302649 GCAGTGAGTAAACGGGAGCATGG + Intronic
1000277817 5:159754555-159754577 GCAGAGAGGTAAGGGGACACTGG + Intergenic
1002819120 6:707358-707380 GCAGTGAGCTAACTGGGGACAGG + Intergenic
1003158460 6:3616297-3616319 TCAGTGAGGTAAGGGGAGAGAGG + Intergenic
1003701579 6:8471792-8471814 GCAGGGAGGTGAAGGGACTCAGG + Intergenic
1005007952 6:21309126-21309148 GCAGTGTGGAAAGGGGAGTGGGG - Intergenic
1007631474 6:43275557-43275579 GCAGTGAGGTAACGGGAGTCAGG - Intronic
1010497205 6:76549422-76549444 GCAGTGAGGAAACAAGAATCAGG - Intergenic
1019064910 6:169288558-169288580 GCAGAGAGGAAGCTGGAGTCTGG + Intergenic
1021316568 7:19155581-19155603 TCAGTTTGGTAACAGGAGTCAGG + Intergenic
1026671837 7:72397557-72397579 GCAATGAGGAAGAGGGAGTCAGG + Intronic
1027419352 7:78004671-78004693 GCAGAGAGGCAGAGGGAGTCTGG + Intergenic
1027545038 7:79517012-79517034 GTATTGAGGTAAAGGGATTCGGG - Intergenic
1029332674 7:99872434-99872456 GCAGTGTGGCATCGGGAGTCAGG + Intergenic
1035034428 7:155885776-155885798 GCCGAGAGGAAACGGGAGGCGGG - Intergenic
1036278377 8:7377560-7377582 GGAGAGAGGGAACGGGAGACAGG - Intronic
1036838481 8:12095094-12095116 GGAGAGAGGGAACGGGAGACAGG + Intergenic
1036860272 8:12341342-12341364 GGAGAGAGGGAACGGGAGACAGG + Intergenic
1037717029 8:21409404-21409426 GGAGAGAGGTAAGGGGAGGCAGG - Intergenic
1039765631 8:40625239-40625261 GCAGTGAGGGACAGGGAGGCAGG + Intronic
1044863450 8:96545975-96545997 GCAGCGAGGCAACAGCAGTCAGG + Intronic
1052769221 9:32672072-32672094 GCAGGGAGGTGTCGGGACTCTGG - Intergenic
1057495813 9:95560102-95560124 CAAGTGAGGAAACGGGAGGCCGG + Intergenic
1062167846 9:135117101-135117123 GCAGTTAGGCAGAGGGAGTCTGG - Intronic
1062538341 9:137030603-137030625 GCAGCGGGCTAACGGGAGGCTGG - Exonic
1190127938 X:47722641-47722663 GCAGTGAGGTGACAGGAGGCAGG + Intergenic
1191258463 X:58290071-58290093 GCAGTGAGGCCAGAGGAGTCTGG + Intergenic