ID: 1007632417

View in Genome Browser
Species Human (GRCh38)
Location 6:43279979-43280001
Sequence GCTCCCTACCTGGCTCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007632417 Original CRISPR GCTCCCTACCTGGCTCAAAC AGG (reversed) Intronic
905825568 1:41023724-41023746 GATCCCCACCTGGCTCTGACAGG + Intergenic
909133430 1:71767857-71767879 GCTCCAGACATGGCTCAAAGGGG + Intronic
909725181 1:78826474-78826496 GCTCTCTTCCTGGCTTAAAGTGG - Intergenic
910602023 1:89042756-89042778 GCTCCCTGCGAGGCTGAAACTGG + Intergenic
910765745 1:90780434-90780456 GCTCCCTACCTCACACAAAATGG - Intergenic
911725429 1:101237086-101237108 GCCCCCTACCTCGCTCAAGCAGG - Exonic
913234239 1:116766274-116766296 GCACCCTGCCTGGTTCAAGCAGG - Intronic
915162890 1:153932436-153932458 GCTCCCTATCAGGCACAAAGGGG + Exonic
915357683 1:155265730-155265752 TCTCCCTGTCTGGCTCCAACTGG - Intronic
916871404 1:168918449-168918471 GCTCCCTTCCTGCCGCAAATAGG + Intergenic
920416462 1:205802060-205802082 TCTCCCTCCCTGGCCCTAACAGG + Intronic
920708986 1:208277164-208277186 GCACCCTACATGGCTCACAGAGG - Intergenic
922134485 1:222811668-222811690 ACTCGCCAACTGGCTCAAACAGG - Intergenic
922161292 1:223080673-223080695 GCTCCATGCCTGGCTCACACAGG + Intergenic
1063886636 10:10586635-10586657 GCTCACTACCTGGGTGAACCTGG + Intergenic
1064364084 10:14691480-14691502 GCTCACTGCCTGGCTCATACTGG - Intronic
1066494650 10:35930839-35930861 GCTCCTGACCTTACTCAAACTGG - Intergenic
1066647741 10:37626997-37627019 GCTCCTGACCTTACTCAAACCGG + Intergenic
1071151833 10:82644851-82644873 TTCCCCTACATGGCTCAAACAGG + Intronic
1073124565 10:101141399-101141421 GTTCCCTGCGTGGCTCAAAAGGG + Intergenic
1074550296 10:114436534-114436556 GCTCCTCACCTGGCCCAACCAGG - Intronic
1075838547 10:125477264-125477286 GCACCCTGCCTGGCTCCAGCAGG + Intergenic
1075874098 10:125792374-125792396 TCTCCATCCCTGGCACAAACTGG + Intronic
1076132664 10:128024714-128024736 GCTCCCTGCCTGGCTTGGACTGG - Intronic
1076189731 10:128474689-128474711 GCTGCCCTCCTGGCTCACACTGG + Intergenic
1077845165 11:6015348-6015370 GCTCCATCCCTGGTTCAAAGTGG + Intergenic
1083785841 11:64946334-64946356 GATCCCTAAGTGTCTCAAACTGG - Intronic
1084559534 11:69895154-69895176 GCTCCCTGGCTGGCACAGACAGG - Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1089342138 11:117765205-117765227 GCTCTGTGCCTGGCTCCAACCGG + Intronic
1089592002 11:119547599-119547621 GCTCCCTACGAGGCTGCAACTGG - Intergenic
1091589247 12:1833669-1833691 GCTCCCTTCCTGGCGTAAAGAGG - Intronic
1092122992 12:6057543-6057565 GCTCCCTACGTTGCCCAGACTGG + Intronic
1092387087 12:8044078-8044100 GCTTCCTACCTGGCTGTAGCTGG - Exonic
1096907268 12:54946967-54946989 GCTCCCCACCAGGCTGAATCAGG - Intergenic
1097710841 12:62915377-62915399 GCTCCCTGCGTGGTTCAATCAGG + Intronic
1114344629 14:21781743-21781765 GCTCCCTGCCAGGCTGAAGCTGG - Intergenic
1114587331 14:23826611-23826633 GCTCCGTACCTGGCTCCTAAAGG - Intergenic
1119106586 14:71931117-71931139 GCTCAATACTTGGCTCAAGCCGG - Intergenic
1119651864 14:76389549-76389571 GCTGCCTCCATGGCTCAACCAGG - Intronic
1122637729 14:103138270-103138292 GCTCCCCACGTGGCTCAACCAGG - Intergenic
1123936897 15:25198425-25198447 GCCCCCCACCAGGCTCAAAGAGG - Intergenic
1125629084 15:41132817-41132839 GCTCCCCACCAGGCTGAATCAGG + Intergenic
1125838726 15:42777886-42777908 GATGCCTAACTGGCTCAAATTGG + Intronic
1127502017 15:59562509-59562531 GCTGCCAACCTGTTTCAAACTGG + Intergenic
1129789050 15:78328587-78328609 GCTCCCAACCAGGCTCACATGGG + Intergenic
1129845395 15:78765706-78765728 GCTCCCAGCCTGGCTGAAGCGGG - Exonic
1132051281 15:98609698-98609720 GCTCCCCAGCTGGCTCCAGCAGG + Intergenic
1133421839 16:5653064-5653086 GCACCCCACCTTGCTCACACAGG - Intergenic
1136082827 16:27863880-27863902 GGTGACTACCTAGCTCAAACTGG + Intronic
1137538692 16:49347258-49347280 GCTCCCTTCATGGGTCAAAGTGG + Intergenic
1140479854 16:75256718-75256740 GCTGCCTTGCTGGCTCACACCGG - Intronic
1146708703 17:35021722-35021744 ATTCCCTACTTGGCTCGAACAGG + Exonic
1147258628 17:39196413-39196435 GCTGCCTCCCAGGCTCAAAGGGG + Intronic
1147960702 17:44165943-44165965 CCTCCACACCTGGCCCAAACCGG - Intergenic
1147971106 17:44219482-44219504 GCTCCCTCCCTGGCTCTGAGTGG + Intronic
1151045657 17:70917182-70917204 GCTCCAGCCCTGGCTCAAAGGGG + Intergenic
1151712979 17:75817372-75817394 GCTCCCCACCGGGCTCCATCAGG + Exonic
1152021667 17:77782923-77782945 GCTCCCTCCCTGGGCCACACTGG + Intergenic
1152286037 17:79413882-79413904 GGTCCCTACCAGCCTCATACAGG + Intronic
1158382069 18:56942353-56942375 GATCCCCAACTGGCACAAACTGG - Intronic
1158413828 18:57232020-57232042 TCTCCAGACCTGGCTCAAAAAGG + Intergenic
1162351844 19:10155228-10155250 GCTCTCTGGCTGGCTCAGACAGG - Intronic
1163382220 19:16976606-16976628 CCTCGCTACCTGGGTGAAACTGG + Intronic
1166760395 19:45220759-45220781 TCTCCCTCCCCAGCTCAAACTGG - Intronic
1168248048 19:55124206-55124228 GCTCCCCACCAGGCTGAATCAGG + Intergenic
927884672 2:26710980-26711002 GCTCCATTCCTGGCCCAAATTGG - Intronic
928494766 2:31820417-31820439 GCTCCATCCATGGCTCAAAGGGG - Intergenic
929633989 2:43497529-43497551 CCTCCCTTCCTGACTCCAACAGG - Intronic
930099206 2:47590072-47590094 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
934968446 2:98743403-98743425 TCTCCCTATATGGCCCAAACTGG - Intergenic
936470105 2:112791346-112791368 GCTCCAGCCTTGGCTCAAACGGG + Intergenic
940398362 2:153220116-153220138 GCCCACTACCTGGCTAACACTGG - Intergenic
940865317 2:158812064-158812086 TCTCCCTACCTGCCTCAGTCAGG - Intronic
942732470 2:179075299-179075321 GCTCCCTAAAGGGATCAAACTGG + Intergenic
944250943 2:197579784-197579806 GCTCCCTGCCAGGCTGAATCAGG + Intronic
946874484 2:224114210-224114232 GCTCCCATCCTGGCTGAAAGGGG + Intergenic
1170474146 20:16698246-16698268 TCTCCCTAACTGACTAAAACTGG - Intergenic
1172623721 20:36335766-36335788 GCTCCACACCTGGGTCAAAAAGG - Intronic
1174417979 20:50380106-50380128 TCTCCCTGACTGTCTCAAACGGG - Intergenic
1174477352 20:50805496-50805518 TATCCCTACCTGGCACAAGCTGG + Intronic
1177063108 21:16397398-16397420 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
1184149979 22:42632097-42632119 GCTCCTTCCCTGGCCCAATCTGG - Intronic
1184827157 22:46960147-46960169 GCTTCTTACCTGCCTCCAACAGG + Intronic
1184911751 22:47540041-47540063 GCTCCAGCCCTGGCCCAAACTGG + Intergenic
953155376 3:40366623-40366645 GCTCACTACTGGTCTCAAACTGG - Intergenic
957985612 3:87571023-87571045 GCTCCCCACCAGGCTGAATCAGG + Intergenic
962048792 3:131790451-131790473 ACTCCTTGCCTGGCTCTAACAGG + Intronic
962524106 3:136222291-136222313 GCTCCCCACCAGGCTGAATCAGG - Intergenic
963777344 3:149452402-149452424 GCTCCATCCGTGGCTCAAAGGGG - Intergenic
966785437 3:183619001-183619023 GGTCACCAACTGGCTCAAACAGG - Intergenic
969353965 4:6614389-6614411 CCTCCCTCCCTGAGTCAAACAGG + Intronic
969600183 4:8171499-8171521 GCTCCTTCCCTGCCTCAAGCTGG - Intergenic
974173508 4:58295363-58295385 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
975609863 4:76193113-76193135 GCTCCAGACATGGCTCAAAGGGG + Intronic
976798223 4:88958351-88958373 GCTCCACCCCTGGCTCAAAGGGG + Intronic
977092398 4:92694330-92694352 GCTCCCTACCAAGCTCCAAAAGG + Intronic
978411677 4:108432948-108432970 GCTGCCTACCTTGCTCAACTAGG - Intergenic
983801275 4:171932498-171932520 GCTTCCAACCTGGCTCCAAATGG - Intronic
991196110 5:63934427-63934449 GCTCCCAACCTGGTTCACTCTGG - Intergenic
992157478 5:73969425-73969447 CCTCCCTCCCTGGGGCAAACAGG - Intergenic
997732586 5:136192136-136192158 CCTCCCTACCAGGCTCAAGCTGG + Intergenic
1000251305 5:159498067-159498089 GCTCCTTGCCTGGCACAAAGAGG - Intergenic
1001354607 5:171007422-171007444 GCTCCCTGCCAGGCTGAATCAGG - Intronic
1005583631 6:27255261-27255283 GCTACAGACCTGGCTCAAGCTGG + Exonic
1007632417 6:43279979-43280001 GCTCCCTACCTGGCTCAAACAGG - Intronic
1007632420 6:43280057-43280079 GTTCCCTACCTGGCCCAAACAGG + Intronic
1011666313 6:89638263-89638285 GCTGCCTACCGGGCTGAAAAGGG + Intronic
1015722001 6:136252044-136252066 GTTTTCTACCTGGATCAAACTGG - Intergenic
1015806038 6:137109684-137109706 GCTCTGCACATGGCTCAAACTGG - Intergenic
1023106140 7:36764891-36764913 ACTCCCAAACTGGCACAAACAGG - Intergenic
1025829300 7:65036039-65036061 GCTCCCTATGTTGCTCAGACTGG + Intergenic
1030173381 7:106627242-106627264 TCTCCCTACATCGCCCAAACTGG + Intergenic
1031265177 7:119572354-119572376 GCTCCCACCCTAGCTCAGACAGG - Intergenic
1032481603 7:132251492-132251514 GCTCCCTAGCTGGCTGGCACTGG + Intronic
1032868159 7:135950410-135950432 GCTCCTTACCTACCACAAACTGG + Intronic
1037162533 8:15790606-15790628 GCTTACTTCCTGGGTCAAACAGG - Intergenic
1038628253 8:29215491-29215513 TCTCCCTACGTTGCTCAAGCTGG - Intronic
1045376287 8:101577814-101577836 ACTGCCTACTAGGCTCAAACGGG - Intronic
1048955864 8:139535361-139535383 CCTCCATATCTTGCTCAAACTGG + Intergenic
1053003809 9:34591580-34591602 GCTCCCAACCTGGCAGAAAGAGG - Intergenic
1053098154 9:35347093-35347115 TCTCCCTACCTTGCCCATACTGG + Intronic
1053134066 9:35638337-35638359 GCTCCCCACCAGGCTGAATCAGG + Intronic
1053414522 9:37938726-37938748 GCTCCATCCCTGGCTCAGACGGG + Intronic
1055073170 9:72188418-72188440 GCTCCCACCATGGCTCAAGCAGG + Intronic
1062271906 9:135713698-135713720 GCTCCTTACCTGGCCCAGGCCGG - Intronic
1187180547 X:16939555-16939577 GCTCCAGCCCTGGCTCAAAGGGG - Intergenic
1189031902 X:37459852-37459874 GCTCCCTGCCAGGCTGAATCAGG - Intronic
1192092473 X:68174665-68174687 TCTCCCTACATTGCCCAAACTGG + Intronic
1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG + Intergenic
1195869755 X:109473635-109473657 GCTCCCTCCCTGCCTCAAAGGGG + Intronic
1199981348 X:152922235-152922257 GATCCACTCCTGGCTCAAACAGG + Exonic
1201307590 Y:12563965-12563987 GCTCCCCACCAGGCTGAATCAGG - Intergenic