ID: 1007633602

View in Genome Browser
Species Human (GRCh38)
Location 6:43285561-43285583
Sequence GCGCGGGGCCGCGTCCCCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007633602 Original CRISPR GCGCGGGGCCGCGTCCCCCA CGG (reversed) Exonic