ID: 1007633786

View in Genome Browser
Species Human (GRCh38)
Location 6:43286276-43286298
Sequence GGGTCCTGAGCACTAGATCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007633786 Original CRISPR GGGTCCTGAGCACTAGATCA GGG (reversed) Exonic
900435777 1:2629861-2629883 TGGGCCTGAGCGCTAGGTCAGGG + Intronic
900544694 1:3222146-3222168 GGGACCTGAGCTCAAGGTCACGG - Intronic
901734234 1:11302118-11302140 GGGTGCTGAGGACTAGTTCTTGG + Intergenic
902107604 1:14050772-14050794 GGGTCCTCAGCACTGGCACATGG - Intergenic
903548206 1:24140447-24140469 GGGACCTGAGCACCTGATAAAGG + Intronic
904273409 1:29365009-29365031 GGGCCCTGAGCACTAGGCTAAGG - Intergenic
905482592 1:38271635-38271657 GGGGCCAGAGCACTGGAGCAGGG - Intergenic
906108116 1:43306796-43306818 GGGGCCTCAGCACTACATGAGGG - Intronic
906595023 1:47068416-47068438 AGGTCCTGAGCACTTGCCCAGGG + Intronic
907600821 1:55767629-55767651 GGGTCCTGATCCATAGATTAGGG + Intergenic
908510795 1:64848592-64848614 GGGTCCTCAGAAATAGATCATGG - Intronic
908808518 1:67955672-67955694 GAATCCTGAGCACAAGATGAGGG - Intergenic
913068016 1:115274900-115274922 GGGTCCTGAGCACCACGACAGGG - Intergenic
915715148 1:157938462-157938484 GTGTCCTCAGCACTAGAACATGG - Intergenic
915718923 1:157969471-157969493 GGGTTCTGACCACTGAATCAGGG + Intergenic
918107981 1:181429556-181429578 GGCTCCTGAGCAATAGACCCAGG - Intronic
922570349 1:226631072-226631094 GGGTCTGGAGAACTAGTTCATGG - Intergenic
923041302 1:230321921-230321943 GGCTCCTGTGCTCTAGATCATGG - Intronic
1063715062 10:8519047-8519069 GGGTCTTGAGCAGAAGATAAGGG + Intergenic
1065790508 10:29255925-29255947 GGGTCCTGACCCCCAAATCAGGG - Intergenic
1067845128 10:49713520-49713542 GGATCCTGAGCACTGGCTCCAGG + Intergenic
1069222336 10:65900365-65900387 GGGTCATGATAATTAGATCATGG + Intergenic
1069958011 10:72063379-72063401 GGGGCCTGAGCAGTGGTTCAAGG - Intronic
1073481340 10:103787903-103787925 GTTTACTGAGCACCAGATCAAGG + Intronic
1073960940 10:108926899-108926921 TGGTCCTGGGCACTAGATTAAGG + Intergenic
1075835321 10:125448074-125448096 GTGACCTGAGCTCTAGATGATGG + Intergenic
1075935004 10:126332827-126332849 GGGTCCTGAGCAAGAGACCCTGG - Intronic
1077096696 11:802021-802043 GGGTCCTGACCACCACTTCACGG + Exonic
1077210611 11:1369479-1369501 GGGAACTCAGCAATAGATCAGGG + Intergenic
1078141027 11:8693240-8693262 GGGAACTGAGTACTAGATTAAGG - Intronic
1078341408 11:10500052-10500074 AGGTCCTGAGCACCAGGCCAAGG - Intronic
1089174807 11:116540735-116540757 GGGTCCTGGGCACATTATCAAGG + Intergenic
1089218682 11:116852439-116852461 GGGTCATGAGCACAAGTTCTGGG + Intronic
1089290098 11:117432386-117432408 GGGTCCTGTGCTCTGGATGAGGG + Exonic
1097308507 12:58094448-58094470 GGTGCCTGAGAACTAGTTCATGG - Intergenic
1098534070 12:71575022-71575044 ATGTTCTGAGCACAAGATCAGGG + Intronic
1099876239 12:88409465-88409487 GGATCCTGAGCAGGAGAGCAAGG + Intergenic
1102927821 12:116839874-116839896 GCTTCCTGAGCCCTAGCTCAGGG - Intronic
1104001821 12:124864651-124864673 GCGTCCTGAGCTCTAGAACGTGG + Intronic
1106316961 13:28602826-28602848 GGGACCTGAACAATATATCATGG - Intergenic
1115870313 14:37793464-37793486 GGGTCCTGAGATGTAGATAATGG - Intronic
1116857604 14:49966692-49966714 CGGGCCTGAGCAATAGCTCATGG - Intergenic
1117069695 14:52045091-52045113 AGATCATGAGCACTAGATTAGGG + Intronic
1121352442 14:93184558-93184580 CGGGCACGAGCACTAGATCACGG - Exonic
1121964897 14:98295054-98295076 CTGTCTTGAGCACTAGAACAAGG - Intergenic
1130430995 15:83846632-83846654 GGGGCCTGAGGATTAGAACATGG - Intronic
1131351970 15:91709311-91709333 GGGTCCTGGGGACTTGAGCATGG + Intergenic
1132956213 16:2595333-2595355 GGATCCTGAGCACTGAATCAGGG + Intronic
1140785056 16:78332941-78332963 GGGTTCTGAGCAACAGAACATGG - Intronic
1143083888 17:4401522-4401544 GGGTCCTAAACTCTAGAGCAGGG + Intergenic
1143101498 17:4507024-4507046 GAGTCCAGAGCACTGGCTCAGGG + Intronic
1148123828 17:45226871-45226893 GGGTCCTCAGCACCTGATCCTGG + Intronic
1151552342 17:74829448-74829470 GGCTCCTGAGCACTGGAACATGG - Intronic
1155248981 18:23937852-23937874 GCGTTCTGAGCACTATATCCAGG + Intronic
1158241747 18:55385834-55385856 GGGCCCTGAGAACTTGAGCAGGG - Intronic
1159999883 18:75007429-75007451 GGGTCGTGAGGACTAGACTAAGG - Intronic
1163608323 19:18287928-18287950 GGGTCCTAAGCGCTGGATTAGGG - Intergenic
1164695120 19:30237916-30237938 TGGTCCTGAGCTCTTTATCATGG - Intronic
1168340216 19:55618656-55618678 GGGTCTTCAGCATTAGAACATGG - Intergenic
927640755 2:24844028-24844050 GGGGCATGAGAACTAGCTCATGG + Intronic
928210197 2:29318381-29318403 TGGTACTGAGCAATAGAGCATGG + Exonic
932731899 2:74227314-74227336 GGGTCCTGAGCCCTGGGTGAGGG + Intronic
934579773 2:95428580-95428602 GGGTCCTGACCTCTAAACCAGGG + Intergenic
934599674 2:95648145-95648167 GGGTCCTGACCTCTAAACCAGGG - Intergenic
943029616 2:182670360-182670382 GAGTCCTGAGCTCTACAACAGGG + Intergenic
944322575 2:198365251-198365273 GAGTCCTAAGGACTAGACCAAGG - Intronic
944445058 2:199780680-199780702 GGGTTCTGAGCCCTAGCTTAGGG + Intronic
946536015 2:220629276-220629298 GGGTCATGAGCACCAGAACCAGG + Intergenic
1169091943 20:2866277-2866299 GGGTCCCGAGCAGAAGGTCAAGG + Exonic
1170041969 20:12048670-12048692 GGGATATGAGCAGTAGATCATGG - Intergenic
1172326344 20:34038294-34038316 GGGTCCTGAGCCTGAGAACATGG + Intronic
1173484389 20:43429671-43429693 TGGTCCTGAGCTCTATATCAAGG - Intergenic
1174164744 20:48576723-48576745 GGGTTCTGTGCACTAGCTCCTGG + Intergenic
1179879933 21:44289259-44289281 GGGTCCTGAGCCCAGGAACAAGG - Intronic
1180971134 22:19816287-19816309 GGGTCCTGACCAGGCGATCAGGG - Intronic
1183493566 22:38129259-38129281 GGGCCCTGAGCAGTAGATGCAGG - Intronic
1185082031 22:48714813-48714835 GGGCCCTGACCACTTGATCTTGG - Intronic
949754966 3:7398798-7398820 GGGACCTGAGCACTCAAACAGGG - Intronic
953605264 3:44409664-44409686 GGGACCTGAGCTCCAGCTCAGGG + Intergenic
954644919 3:52125377-52125399 TGTTCCTGAGCACTACAACAGGG + Intronic
959659416 3:108849373-108849395 GGGACCTGAGCTCTAACTCAGGG + Intronic
960502317 3:118453150-118453172 GGGACCTGATGACTGGATCAAGG + Intergenic
967466622 3:189813731-189813753 TTGTGCTGGGCACTAGATCAGGG - Intronic
971150219 4:24023473-24023495 GTGTCCTGAACACTACAGCAGGG - Intergenic
986722828 5:10572279-10572301 GGGTCCTGAGACCTGGAGCAGGG + Intronic
992371375 5:76147499-76147521 GGGTCCAGAGCACTTCAGCATGG + Intronic
993344136 5:86761486-86761508 GGGTCCTGAGCAATAACACAGGG - Intergenic
995348672 5:111150038-111150060 GGGTCCTCAGCATTACAGCAAGG - Intergenic
1001994653 5:176146652-176146674 GTGTCCTGAGGACCAGATGATGG - Intergenic
1002105434 5:176877461-176877483 GGGTCCTGAGGGCTAGGCCAAGG - Intronic
1003846024 6:10174172-10174194 GATTCCTGAGCACCAGAGCATGG - Intronic
1005813289 6:29531947-29531969 GTGTCCTCAGCATTAGACCAGGG + Intergenic
1007633786 6:43286276-43286298 GGGTCCTGAGCACTAGATCAGGG - Exonic
1013445284 6:110220200-110220222 GGGGACTGAGCATAAGATCATGG + Intronic
1013542221 6:111122100-111122122 GGGTCCTGGGTACAAGCTCAGGG + Intronic
1013830579 6:114267894-114267916 GGATCATGAGAACTAGAACAGGG - Intronic
1018143544 6:160863035-160863057 GAATCCTGATCTCTAGATCAGGG + Intergenic
1023556140 7:41424736-41424758 AGGTCCTCAGCACCACATCAGGG - Intergenic
1023793456 7:43771795-43771817 TGGTGCTGAGCACCAGATAAGGG - Intronic
1026878235 7:73891956-73891978 GGGTTCTGAGGACTGGCTCAGGG - Intergenic
1031615699 7:123876566-123876588 GGCTCCTGGGCACTATAACAAGG - Intronic
1033159679 7:138984232-138984254 GGGTCCTGGGCACCTGAGCATGG - Intergenic
1034976284 7:155450718-155450740 CGGGCGTGAGCACTCGATCAAGG + Intergenic
1035097730 7:156369102-156369124 GGGTCCTCTGCTCTGGATCATGG - Intergenic
1035650169 8:1257854-1257876 GGGTCCTTGACACTAGTTCAGGG + Intergenic
1037339878 8:17832904-17832926 GGGTTCTGGGCATTAGAACATGG + Intergenic
1038225169 8:25649688-25649710 GCCTCCTGAGGACTTGATCATGG + Intergenic
1040384540 8:46905330-46905352 GGGTCATGAGCAGCAGATCTGGG - Intergenic
1041151484 8:54939811-54939833 TGGGCCTGTGCACGAGATCATGG - Intergenic
1047212297 8:122849754-122849776 GGGTTCTGAGGACTAGGACATGG + Intronic
1048468973 8:134690402-134690424 GGATCCTGAGGTCTTGATCAAGG + Intronic
1059444280 9:114328589-114328611 GGGTCCTGAGAGCTAGTACAGGG + Intergenic
1059651858 9:116322611-116322633 GGGTCCTGAGGACTACAGGAGGG - Intronic
1187323756 X:18267474-18267496 TGGTCCTGAGCTATAGAACAAGG + Intronic
1187507081 X:19887070-19887092 GGGGCCTGAGCAGACGATCACGG - Intronic
1198937094 X:141909904-141909926 GGCTTCTGAGCACCACATCAAGG - Intergenic
1198961958 X:142192961-142192983 GGCTTCTGAGCACCACATCAAGG + Intergenic