ID: 1007634036

View in Genome Browser
Species Human (GRCh38)
Location 6:43287410-43287432
Sequence ACCAGGGTGTTGTTGGTCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007634036_1007634047 0 Left 1007634036 6:43287410-43287432 CCCAGGACCAACAACACCCTGGT 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1007634047 6:43287433-43287455 TTGGAGCTGGGAGGAAGAAGGGG 0: 1
1: 0
2: 8
3: 127
4: 1527
1007634036_1007634048 1 Left 1007634036 6:43287410-43287432 CCCAGGACCAACAACACCCTGGT 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1007634048 6:43287434-43287456 TGGAGCTGGGAGGAAGAAGGGGG 0: 1
1: 0
2: 13
3: 147
4: 1171
1007634036_1007634049 18 Left 1007634036 6:43287410-43287432 CCCAGGACCAACAACACCCTGGT 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1007634049 6:43287451-43287473 AGGGGGCCTGAGAGAGCCCCAGG 0: 1
1: 0
2: 5
3: 55
4: 438
1007634036_1007634046 -1 Left 1007634036 6:43287410-43287432 CCCAGGACCAACAACACCCTGGT 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1007634046 6:43287432-43287454 TTTGGAGCTGGGAGGAAGAAGGG 0: 1
1: 0
2: 4
3: 81
4: 635
1007634036_1007634042 -9 Left 1007634036 6:43287410-43287432 CCCAGGACCAACAACACCCTGGT 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1007634042 6:43287424-43287446 CACCCTGGTTTGGAGCTGGGAGG 0: 1
1: 0
2: 2
3: 12
4: 242
1007634036_1007634045 -2 Left 1007634036 6:43287410-43287432 CCCAGGACCAACAACACCCTGGT 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1007634045 6:43287431-43287453 GTTTGGAGCTGGGAGGAAGAAGG 0: 1
1: 0
2: 4
3: 79
4: 914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007634036 Original CRISPR ACCAGGGTGTTGTTGGTCCT GGG (reversed) Exonic
900245468 1:1634240-1634262 ACCAGCCTGGTTTTGGTCCTGGG - Exonic
900256699 1:1701399-1701421 ACCAGCCTGGTTTTGGTCCTGGG - Intronic
902582634 1:17418109-17418131 TCCAGGGTGCAGTTGCTCCTTGG - Intronic
903266960 1:22163447-22163469 ACCTGGGTGTTGCTGGACCTTGG + Intergenic
904492214 1:30868134-30868156 GGCAGGGTGCTGTTGGCCCTGGG - Intergenic
904684795 1:32252159-32252181 ACAGGGGTGCAGTTGGTCCTGGG + Intronic
904754326 1:32759794-32759816 ACCAGGGAGTGGTTGAACCTGGG - Intronic
905932095 1:41796010-41796032 ACTAGGGTATTATTGGTTCTAGG + Intronic
910150554 1:84138023-84138045 ACTGGGGTGTTGTTGCTTCTAGG - Intronic
912111788 1:106351262-106351284 ACTTGGGTGTTGTTGCTTCTAGG - Intergenic
912594053 1:110856473-110856495 ACCAGGCTGTTGTCTGTACTTGG + Intergenic
916142374 1:161711043-161711065 ACCAGGGTGCTCTAAGTCCTAGG + Intronic
916232119 1:162550797-162550819 ATCAAGGTGTTGTTGGCCCCGGG + Intergenic
918966557 1:191357418-191357440 ATCAGTGTGTTTTTGGTCCCAGG + Intergenic
922879727 1:228971550-228971572 GCCAGGGAGTTGGTGGTCCGTGG + Intergenic
923039557 1:230309874-230309896 ACCAGACTGTGGTGGGTCCTCGG + Intergenic
1063667054 10:8068946-8068968 TCCAGAGTGTTTTTGGTGCTTGG + Intronic
1069716830 10:70526527-70526549 ACCAGGCTGTTGAAGGGCCTTGG + Intronic
1070663523 10:78327716-78327738 ATGTGGGTGTTGTTGGTCATGGG + Intergenic
1072736453 10:97882649-97882671 GGGAGGGTGTTGTTTGTCCTGGG - Intronic
1073994390 10:109299137-109299159 AACAGAGTGATGTTGGTTCTTGG - Intergenic
1077537283 11:3130466-3130488 CCCAGGGTGTCTGTGGTCCTGGG + Intronic
1077968567 11:7162973-7162995 ATTAGGGTGTTGTTGCTTCTAGG - Intergenic
1081936633 11:46908784-46908806 ACTCGAGTGTTGTTGGTCCAGGG + Intronic
1089167470 11:116488288-116488310 AGTAGGGTGTGGTTGGCCCTGGG + Intergenic
1097602394 12:61709715-61709737 AGCAGGGTGTTGTTAGCCTTAGG + Exonic
1110366025 13:74686697-74686719 ACTAGGGTGTTTTTGCTTCTAGG - Intergenic
1112572509 13:100606840-100606862 CCCAGAGTGTTGTAGGTTCTTGG - Intronic
1114790871 14:25656887-25656909 ACCAGTCTGTTGTAGGGCCTGGG + Intergenic
1116250829 14:42481296-42481318 CACAGACTGTTGTTGGTCCTTGG - Intergenic
1116902451 14:50374768-50374790 ACTAGGATGTGGTTGGTTCTAGG - Intronic
1118983238 14:70732727-70732749 ACCAGGGGGTTGTGGGTACATGG + Exonic
1119651160 14:76384476-76384498 ACCAGGCAGTTTTTGCTCCTGGG - Intronic
1122790610 14:104182750-104182772 ACCGGGGTGATGCTGGTCCCAGG + Intergenic
1128533786 15:68474498-68474520 ACCAGGGTGTCTTTGATTCTAGG - Intergenic
1128567468 15:68710837-68710859 AACAGGATGTTGTTGGTGGTGGG - Exonic
1128786777 15:70403470-70403492 ACCTGGGTGTTGTTTGCTCTGGG - Intergenic
1129004529 15:72361127-72361149 GCCAGGGTGTTGTAAGTGCTGGG + Intronic
1132407295 15:101551605-101551627 CCCAGGATGTTGTTGGAGCTCGG + Intergenic
1133304091 16:4799190-4799212 ACCAGGGTGATGTGGCTCCCAGG + Intronic
1133444265 16:5846617-5846639 AGCAGGGTCTTGCTGTTCCTTGG - Intergenic
1137512902 16:49117004-49117026 ACCACGGTGTTGTGGGGGCTGGG - Intergenic
1137606057 16:49787619-49787641 GCAAGGGTGGTGTTGGTGCTAGG - Intronic
1138208405 16:55142438-55142460 CCCAGGGTCTGGTTGGTCATAGG - Intergenic
1138679121 16:58672309-58672331 TCCAGGCTGATGTTGCTCCTAGG - Intronic
1140931300 16:79630703-79630725 ACAAGGGAGTTGTTTCTCCTTGG - Intergenic
1141435746 16:83998870-83998892 ACCAGGCTGATGTAGCTCCTTGG + Intronic
1141896610 16:86962592-86962614 CCCAGGGTTTGGTTGATCCTGGG - Intergenic
1142619971 17:1159021-1159043 ACCAGGCTGCTGTGGGTCCAAGG - Intronic
1151500140 17:74483098-74483120 ACAAGGCTGTTGCTGGTCCCAGG - Intronic
1152439128 17:80294668-80294690 TCCAGGGTTTTGATGGTCTTAGG + Intronic
1152526914 17:80893574-80893596 ACCAGGGTGTGTTTGTGCCTGGG + Intronic
1152894735 17:82904477-82904499 TCCAAGGTGATGTTAGTCCTGGG - Intronic
1156036135 18:32770215-32770237 ACCAGGTTGTTGATGGCCCGGGG + Exonic
1156400416 18:36734425-36734447 ACCAGGGTGATTTTGCTCCTAGG - Intronic
1156541784 18:37919187-37919209 ACTATGGTGTTGTTAGTACTTGG + Intergenic
1159260613 18:66006865-66006887 ACCAGAGTGTTATTGGGCTTGGG + Intergenic
1161780443 19:6288092-6288114 ATTAGGGTGTTGTTGGCACTAGG + Intergenic
1164428804 19:28168891-28168913 ACCAGGGGGATGTTGGGCCTGGG - Intergenic
1164712837 19:30370381-30370403 CCCAGGGTGTTTTTGTTCTTTGG + Intronic
1167123328 19:47532053-47532075 TCCAGGGTGTTTTTCCTCCTAGG - Intronic
1168461755 19:56565572-56565594 ACTAGAGTCTTGTTGGACCTTGG - Intergenic
929034958 2:37681800-37681822 ACCAGGCTGTTGTTGGCCTTGGG + Intronic
932047060 2:68360321-68360343 ACCAGGGTGTTGTCGCTTCTAGG + Intergenic
934792403 2:97072643-97072665 ACCAGGATGGTTTTGCTCCTAGG + Intergenic
934814216 2:97311066-97311088 ACCAGGATGGTTTTGCTCCTAGG - Intergenic
934823478 2:97397417-97397439 ACCAGGATGGTTTTGCTCCTAGG + Intergenic
939689321 2:145238198-145238220 ACCAGGGTGATTTTGTTCCCAGG - Intergenic
942456234 2:176140449-176140471 ACGAGCTTGTTGTTTGTCCTGGG + Intergenic
946829874 2:223717669-223717691 ACAAGGGTAGTGTTGGTCCGAGG + Intergenic
946878606 2:224155540-224155562 ATAAGGGAGTTGTTGGGCCTGGG - Intergenic
947537135 2:230947221-230947243 ACCAGAGTTTTGTTGGTTATGGG + Intronic
1169632414 20:7647840-7647862 ACCTGGGTGTTGTTGCACCTCGG - Intergenic
1172522117 20:35574322-35574344 ACTAGGATGTTGTTGATTCTAGG + Intergenic
1178405931 21:32323161-32323183 ACCATGATGGTTTTGGTCCTGGG - Intronic
1179898389 21:44376235-44376257 ACCAGGATGTTCATGGTACTCGG + Intronic
1181808461 22:25389638-25389660 ACTATGGTTTTGTAGGTCCTGGG + Intronic
1184524320 22:45012871-45012893 AGCATGGTGTTGTAGGACCTTGG - Intergenic
1185035545 22:48474877-48474899 ACCTGGGATTTGTTGGTCATTGG - Intergenic
952531099 3:34262771-34262793 ACCAGGGTCATCTTAGTCCTGGG + Intergenic
954783339 3:53075866-53075888 AGCAGGGTGCTGGTGGCCCTGGG + Intronic
955785858 3:62538259-62538281 GCCAGGAAGTTGTTGCTCCTGGG + Intronic
961480646 3:127177605-127177627 AACAGGGTGTTTTAGTTCCTGGG + Intergenic
967690912 3:192472569-192472591 TCCAGGGTGTTGTGAGTCTTTGG - Intronic
968088313 3:195884717-195884739 ACCAGGGTGTGGATGGGACTGGG - Intronic
968958269 4:3730141-3730163 TCCAGGGTGGTGTTGGTTCCTGG + Intergenic
974245734 4:59315123-59315145 ACCAGGTTGTTGTTGGACCAAGG - Intergenic
974351949 4:60759790-60759812 ACCAGGATGTTGTTGCTTCTAGG - Intergenic
981134324 4:141192703-141192725 GGCAGGGTGTTGTTGGTGATAGG - Intronic
982901603 4:161011117-161011139 ACCAGGTTGTATCTGGTCCTTGG - Intergenic
998824203 5:146084436-146084458 ACCAGGGTGTCCTTAGTCATTGG + Exonic
1003339521 6:5206162-5206184 ACCAGGGTGTTTCTGGGACTTGG + Intronic
1006122842 6:31817588-31817610 ACCAGGGTGCCGGTGGTCCCGGG + Exonic
1006124705 6:31829782-31829804 ACCAGGGTGCCGGTGGTCCCGGG + Exonic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007634036 6:43287410-43287432 ACCAGGGTGTTGTTGGTCCTGGG - Exonic
1007804233 6:44426945-44426967 GCCAGGGTGTTTTTGGTTCATGG + Intronic
1007952168 6:45882163-45882185 TCCAGGGTGTTTTTGGTAATTGG - Intergenic
1012805169 6:103884602-103884624 ATCAGTGAGTTGTTGGGCCTGGG - Intergenic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1035407966 7:158612721-158612743 TCCAGGGTGTTTTTTGTGCTGGG - Intergenic
1037979726 8:23243501-23243523 ACCAGGATGTGGTTTGGCCTGGG - Intergenic
1038421778 8:27438276-27438298 ACCAGGGTGATGTCTGGCCTAGG - Intronic
1038769885 8:30467586-30467608 ACCAGGATGTTTCTGCTCCTGGG + Intronic
1039853214 8:41389985-41390007 ACCATGGTGTTGTTGCTTGTAGG - Intergenic
1040076149 8:43233405-43233427 ACCAGTGTGCTGTCTGTCCTAGG + Intergenic
1041520417 8:58749899-58749921 ACCAGGCTGCTGTTGGTACTTGG + Intergenic
1042400238 8:68336658-68336680 ACCAGGATGTTGTTATTCCCAGG - Intronic
1043593774 8:81861043-81861065 ACCTGGGTGATGTTGGTGATTGG - Intergenic
1044759930 8:95507302-95507324 CCCAGTGTGTTGTAGTTCCTTGG - Intergenic
1046892604 8:119439280-119439302 ACAAGGGTGTTCTTGTGCCTGGG + Intergenic
1047949424 8:129918097-129918119 AACAGGGTGGTGGTGGTCCATGG - Intronic
1050531414 9:6593081-6593103 ACTAGACTCTTGTTGGTCCTGGG + Intronic
1052339795 9:27353865-27353887 AGCAGGCTGCTGTTGGCCCTTGG - Intronic
1058440975 9:105006789-105006811 ACCAAGGTGTTACTGGTCCCTGG + Intergenic
1058508800 9:105694381-105694403 TCCAGCGTCTTCTTGGTCCTGGG - Intergenic
1059367020 9:113794289-113794311 ACCTGGGTGGTGTTGCTTCTGGG - Intergenic
1060174139 9:121485199-121485221 GCCAGGGTGTCCTTGGTCCCAGG + Intergenic
1060807708 9:126588046-126588068 AGCAGGGTGGTGTTGGTCTGGGG - Intergenic
1186604443 X:11075828-11075850 ACCAGAATGCTGTTGCTCCTAGG - Intergenic
1188854132 X:35171498-35171520 ACCATAGTGTTATTGGTCTTGGG - Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189644740 X:43115740-43115762 ACTAGGTTATTGTTGTTCCTAGG + Intergenic
1189670788 X:43406565-43406587 ACTGGGGTGTTGTTGCTCCTAGG + Intergenic
1194745219 X:97620786-97620808 TCCAGGTTGATGGTGGTCCTGGG - Intergenic
1199765665 X:150940123-150940145 ACCAGGGTGTCATTGCTTCTAGG + Intergenic
1202192869 Y:22262065-22262087 ACCAACTTGTTGTTGGACCTCGG + Intergenic
1202600904 Y:26592120-26592142 ACCAAGGTGTTTGTGATCCTGGG - Intergenic