ID: 1007636752

View in Genome Browser
Species Human (GRCh38)
Location 6:43304223-43304245
Sequence TCCAGGACGTGGAGAGAAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 289}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007636747_1007636752 11 Left 1007636747 6:43304189-43304211 CCAGAGACGAGGCAGGCACAGCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG 0: 1
1: 0
2: 3
3: 22
4: 289
1007636741_1007636752 25 Left 1007636741 6:43304175-43304197 CCGCCCTCCTGCTGCCAGAGACG 0: 1
1: 0
2: 1
3: 30
4: 272
Right 1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG 0: 1
1: 0
2: 3
3: 22
4: 289
1007636744_1007636752 21 Left 1007636744 6:43304179-43304201 CCTCCTGCTGCCAGAGACGAGGC 0: 1
1: 0
2: 2
3: 16
4: 195
Right 1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG 0: 1
1: 0
2: 3
3: 22
4: 289
1007636742_1007636752 22 Left 1007636742 6:43304178-43304200 CCCTCCTGCTGCCAGAGACGAGG 0: 1
1: 0
2: 1
3: 14
4: 248
Right 1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG 0: 1
1: 0
2: 3
3: 22
4: 289
1007636745_1007636752 18 Left 1007636745 6:43304182-43304204 CCTGCTGCCAGAGACGAGGCAGG 0: 1
1: 0
2: 2
3: 28
4: 204
Right 1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG 0: 1
1: 0
2: 3
3: 22
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007636752 Original CRISPR TCCAGGACGTGGAGAGAAAG AGG Exonic
900208133 1:1440169-1440191 TCCTGGACGTTGATAGGAAGCGG + Exonic
900430419 1:2598798-2598820 TAGAGGAAGTGGGGAGAAAGAGG + Intronic
902887763 1:19418547-19418569 TTCAGGAAGTGGGAAGAAAGAGG - Intronic
903449380 1:23442528-23442550 CCCAGGACATGCAGAGAGAGCGG - Exonic
903713917 1:25348844-25348866 TCCAGGAAGAGGAAAGGAAGTGG - Intronic
903852334 1:26315600-26315622 GCCAGGAAGTGGAGAGGGAGGGG - Intronic
905101952 1:35531629-35531651 TACAGGAGGTGGTGAGAACGTGG + Intronic
906536480 1:46553593-46553615 TCCAAGACATGGGGAGACAGAGG + Intergenic
907719868 1:56961614-56961636 TCCTGGATATGGAAAGAAAGAGG - Intronic
908466436 1:64400946-64400968 TCCATGGGGTGGAGAAAAAGGGG - Intergenic
912649474 1:111425161-111425183 TCTAGCAGGTGGTGAGAAAGAGG - Intronic
916640776 1:166726405-166726427 TCCAGGAGAAAGAGAGAAAGAGG + Intergenic
916953516 1:169807527-169807549 ACCAGGCCCTGGAGACAAAGGGG - Intronic
917160815 1:172055175-172055197 ACCAAGAGGAGGAGAGAAAGGGG - Intronic
918109882 1:181446174-181446196 TCCAGGACTGGGAGAGGATGTGG + Intronic
918249256 1:182686850-182686872 TACAGGAGGAGCAGAGAAAGAGG + Intergenic
919581187 1:199375380-199375402 TTCAGGACGAGCAAAGAAAGTGG + Intergenic
920442234 1:205988996-205989018 GACAGGACGTGGAGAGGATGAGG - Intronic
920890951 1:209985376-209985398 TATAGGACGTGGAGTCAAAGAGG - Intronic
921422776 1:214967577-214967599 TCCAGGAGGGGAAGAGAAGGTGG - Intergenic
921465605 1:215483370-215483392 TCCAGCACACGAAGAGAAAGAGG + Intergenic
923279661 1:232430950-232430972 TCCAGAATGAGGTGAGAAAGGGG - Intronic
924047217 1:240044069-240044091 CCCAGGAGGTGGAGAGGCAGAGG - Intronic
1062780033 10:194561-194583 ACCAGGTGTTGGAGAGAAAGTGG - Intronic
1063292011 10:4759206-4759228 TCTAGGAGGAGGAGAGAACGGGG + Intergenic
1063335228 10:5206260-5206282 TCCATGACCTGGGGAGAAAGGGG - Exonic
1063466131 10:6246057-6246079 TCCAGGCCATGGGGAGGAAGTGG - Intergenic
1063626809 10:7698016-7698038 TCCAGGAGGTGGGGGCAAAGGGG - Intergenic
1065129438 10:22605743-22605765 AAAAGGACGTGGAGAGAAGGAGG + Intronic
1065375390 10:25035302-25035324 TCCAGTACGTGGGGAGACTGAGG + Intronic
1065944184 10:30592227-30592249 CCCAGCACTTGGAGAGACAGAGG - Intergenic
1067939291 10:50640099-50640121 TCCCAGACTTGGAGAGAAGGAGG - Intergenic
1068119568 10:52772026-52772048 AAGAGGACATGGAGAGAAAGAGG - Intergenic
1072506710 10:96074964-96074986 TCCAGTCCGTAGGGAGAAAGAGG - Intergenic
1073512797 10:104053037-104053059 TCCTGGATCTGGAGAGAAAGGGG - Exonic
1073790789 10:106938182-106938204 TCCAGGAAGTAGAGAGAAGAGGG + Intronic
1073998666 10:109345242-109345264 TCCAGGGCGATGTGAGAAAGGGG + Intergenic
1074200160 10:111227489-111227511 GCCAAGAGGTGGAGAGAAAGTGG - Intergenic
1074958896 10:118420786-118420808 TCCAGGAGCTGGAGACACAGGGG + Intergenic
1075524212 10:123169035-123169057 TCCATGACATGGAGGGAAAATGG + Exonic
1077150931 11:1072862-1072884 CACAGGACGTGGGGAGAGAGGGG + Intergenic
1077348106 11:2073682-2073704 TTGGGGATGTGGAGAGAAAGTGG - Intergenic
1077394341 11:2313745-2313767 TCCAGGACGTGGTGAGCGTGGGG + Exonic
1077982691 11:7316775-7316797 TGCAAGAGTTGGAGAGAAAGTGG - Intronic
1079075389 11:17382479-17382501 TCCTGCCCGTGGAGAGAAAGTGG + Intergenic
1080579852 11:33633247-33633269 CCCAGGACTTTGGGAGAAAGAGG - Intronic
1080719178 11:34832584-34832606 TCCAGGAAGTGGGGAGGCAGTGG + Intergenic
1081393588 11:42558928-42558950 TCCAGAAAGTGAAGAGGAAGGGG - Intergenic
1082799885 11:57406692-57406714 TTAAGGATGTGGAGAGGAAGAGG + Intronic
1083479844 11:62936770-62936792 TGAAGGACCTGGAGAGAAGGTGG - Intronic
1083484913 11:62977180-62977202 TGCAGGACCTGGAGAGCAGGTGG - Exonic
1084139674 11:67217473-67217495 TCCAGGACTCGGAGAGAAGAGGG - Intronic
1085471286 11:76759870-76759892 TCAAGGAAGTGGAGAGAAAAGGG - Intergenic
1089171671 11:116515968-116515990 TCCAGGACTTGCAGAAAACGTGG - Intergenic
1091680182 12:2521491-2521513 TCCAGGCCCTGGAGAGGAAGAGG - Intronic
1091771705 12:3156350-3156372 TCCAGGACTGGGAGAGGGAGGGG + Intronic
1093119703 12:15254015-15254037 TCCACGATGTGGAGAGGAAAAGG + Intronic
1094625120 12:32116011-32116033 TGCAGGAGGTGGGGAGAAAAGGG + Intronic
1097222051 12:57456759-57456781 TCCAGGTAGAGGAGAGAGAGGGG - Exonic
1097956594 12:65493151-65493173 TTCAGCAAGTGGAGAGGAAGTGG + Intergenic
1099485713 12:83226982-83227004 ACCAGGGGGTGGAGAGCAAGGGG - Intergenic
1100213816 12:92427080-92427102 TCTATGCCGTGGAGAGAAATTGG + Intronic
1100325263 12:93534209-93534231 TCCAGGCAATGGAGAGAAGGTGG + Intergenic
1101221802 12:102649325-102649347 TCCAGGAAATGGAGAAAAAAAGG + Intergenic
1101476609 12:105055517-105055539 TACAAGACGTGCAGAGAAACAGG + Intronic
1101999377 12:109547271-109547293 TCCAGGTCGTGATGAGAAAGTGG - Intergenic
1102900736 12:116634676-116634698 ACCAGGAGCTGGAGAGAATGGGG + Intergenic
1103735783 12:123060027-123060049 GCCAGGACTTGGAGAAAAAAAGG - Intronic
1103839987 12:123855167-123855189 TCCAGGATGTGGAGTGGAAAAGG - Intronic
1103960472 12:124606173-124606195 TGTAGGACATGGGGAGAAAGAGG - Intergenic
1104618291 12:130289551-130289573 TAAAGGCCGTGGAGAGACAGCGG - Intergenic
1104927670 12:132322009-132322031 TCTAAGACGAGGAGAGACAGTGG - Intronic
1105208394 13:18242329-18242351 TCCAGTACTTAGAGAGAACGAGG - Intergenic
1105753255 13:23441306-23441328 CCCAGGACGGGGAAAGAAACAGG - Intergenic
1106399634 13:29417176-29417198 TGCATCACATGGAGAGAAAGGGG + Intronic
1106758837 13:32848288-32848310 TCAAAGACGGGGAGAGAAACTGG - Intergenic
1107282974 13:38757549-38757571 CCCAGGACGTAGAGGGAAACAGG - Intronic
1107795525 13:44047386-44047408 CCCAGGAATTGGAGAGAGAGAGG + Intergenic
1107945995 13:45418244-45418266 TCCAGGAGCCGCAGAGAAAGCGG + Intronic
1108452402 13:50580329-50580351 TCCTGGACTTGAACAGAAAGAGG + Intronic
1112579923 13:100669784-100669806 TCCAGGATGTGGTGGGAATGGGG - Intronic
1112674954 13:101690570-101690592 TGCAGGCTGTGGGGAGAAAGAGG - Intronic
1113437894 13:110307378-110307400 TCCAGGCCGAGGACCGAAAGGGG + Exonic
1113804286 13:113104311-113104333 TTCAGGACGTGGAGGGGAGGGGG - Intergenic
1113928511 13:113954007-113954029 TCCAGGCTGCAGAGAGAAAGGGG - Intergenic
1114151819 14:20048997-20049019 TACAGGACTGGGAGAGAAATAGG + Intergenic
1114686272 14:24534711-24534733 TCCCGGAAGTGGAAAGGAAGAGG - Intergenic
1115888228 14:37997904-37997926 TCCAAGACATGGATACAAAGAGG + Intronic
1116887182 14:50232216-50232238 ATAGGGACGTGGAGAGAAAGGGG + Intergenic
1117880337 14:60307089-60307111 TCAAGAATGTGGAGAGAAACTGG - Intergenic
1118085095 14:62405325-62405347 TTCCGGACCTGAAGAGAAAGAGG + Intergenic
1118186370 14:63542544-63542566 CCCAGAAGGTGGAGAAAAAGGGG + Intronic
1119888487 14:78164425-78164447 TCCAGCAGGGGGAGAGAGAGAGG + Intergenic
1119904407 14:78288429-78288451 TCCAGGAAAGGGAGAGAAATGGG - Intronic
1121211189 14:92209048-92209070 TCCAGAACCCTGAGAGAAAGTGG + Intergenic
1122057158 14:99108227-99108249 TCCAGGACTTTGAGAGGCAGAGG - Intergenic
1122412156 14:101531115-101531137 TCCAGGGCATGGACAGAAAGTGG - Intergenic
1122554211 14:102568313-102568335 TCCTGGAGGTGCAGAGGAAGAGG - Intergenic
1125144188 15:36447285-36447307 TCCAGGACTTGGAGACAAATAGG + Intergenic
1126658006 15:51001517-51001539 GCCAAGAGGTGGAGAGGAAGGGG - Intronic
1130305544 15:82710190-82710212 CCCACGCCGTGGAGGGAAAGCGG + Intergenic
1132209075 15:100007239-100007261 TCCAGGAGGTGGAGGGACTGTGG + Intronic
1132338343 15:101063060-101063082 TCCAGGACCTGGTGATCAAGTGG - Intronic
1132628009 16:901464-901486 ACCAGGATGGGGAAAGAAAGGGG + Intronic
1132692710 16:1188778-1188800 TCCAGGAGGGGGCGAGGAAGCGG - Intronic
1133317907 16:4895400-4895422 TCCTGGTCCTGGAGAGAACGGGG + Exonic
1134363927 16:13559090-13559112 TCTAGGAGCTAGAGAGAAAGTGG - Intergenic
1136067722 16:27770011-27770033 GCCAGGAGGTGAGGAGAAAGTGG + Exonic
1136626589 16:31465665-31465687 TCCAGGACAAGGACAGAAGGTGG - Intronic
1138207616 16:55136255-55136277 TCCGAGATGTGGAGAGAGAGGGG + Intergenic
1138418898 16:56886700-56886722 GCCAGGAAGGGGAGAGAATGGGG - Intronic
1139354712 16:66360760-66360782 TCCCAGGGGTGGAGAGAAAGTGG - Intergenic
1141463455 16:84191705-84191727 CCCAGGACGTGGGGAGCAGGGGG + Intronic
1142335228 16:89485015-89485037 TCCAAGAGGAAGAGAGAAAGCGG + Intronic
1142377372 16:89712811-89712833 GCCAGGAGGTGAGGAGAAAGAGG + Intronic
1142854548 17:2722582-2722604 TCCAACAAATGGAGAGAAAGGGG + Intergenic
1144203796 17:12964891-12964913 TGCAGGTCGTGGAGACAGAGAGG - Intronic
1147217499 17:38909137-38909159 ACCAGGACAAGGAGAGAAACTGG - Intronic
1147366503 17:39962902-39962924 TCCAGGAAGTGGAGTGGGAGGGG + Intergenic
1147518397 17:41143913-41143935 TCAAATAGGTGGAGAGAAAGGGG + Intergenic
1147609135 17:41791440-41791462 GCCAGGACCTGGAGAGAAACTGG - Intergenic
1147806954 17:43138642-43138664 TCCAGCACCTGCACAGAAAGGGG - Intergenic
1148643860 17:49207822-49207844 TGCTGGACCTGGAGAGAAAGAGG - Intronic
1148856106 17:50580095-50580117 GCCATGAGGTGGAGAGAGAGTGG + Intronic
1150485201 17:65538345-65538367 TACAGGACGTGGAAAGGAAAGGG + Intronic
1150601597 17:66655534-66655556 TAAAGGGCATGGAGAGAAAGTGG - Intronic
1150997429 17:70334790-70334812 TTCAGGACATGGAGGGTAAGTGG - Intergenic
1152077918 17:78169976-78169998 TCCAGGAGGTGAAGACACAGGGG + Intronic
1152729953 17:81964950-81964972 TCCAGGAGATGGAGAGAAACAGG + Intergenic
1153778365 18:8473481-8473503 GCCAGGACCTAGAGAGAGAGGGG + Intergenic
1155507606 18:26548318-26548340 TCCAGGAGGTGCAGATAACGGGG - Intronic
1156875186 18:42001992-42002014 TGCAGGAGGTGTAGAGGAAGTGG + Intronic
1157730992 18:50004139-50004161 TACAAGATGTGGAGAAAAAGTGG + Intronic
1158186541 18:54778297-54778319 TGAAGGACGTGGAGAAACAGTGG - Intronic
1158404854 18:57151891-57151913 TCCAGGAAGTGGAGAGGGAATGG - Intergenic
1160429212 18:78800114-78800136 TCCGGGATTTGGAGAGACAGCGG - Intergenic
1160499247 18:79394292-79394314 TCCTGGAGGTGGGGAGAAGGAGG + Intergenic
1161316739 19:3620785-3620807 TCCAGGCCCTGGAGAAGAAGGGG - Exonic
1162740875 19:12772905-12772927 GCCAGGACCTGGGGAGAAGGGGG + Exonic
1162851080 19:13431385-13431407 TGCAGGGGGTGGAGAAAAAGAGG + Intronic
1166305281 19:41934036-41934058 GCCAGGAAGTGGGGAGGAAGGGG + Intergenic
1166925696 19:46265618-46265640 TCAAGGACAGGGAGAGAAATAGG - Intergenic
1167135715 19:47614053-47614075 TCCAGGAGGAGGAGAGAGAACGG + Intronic
1168080751 19:54008456-54008478 TCCAGGGTCTGGAGAGAAGGCGG + Intronic
1168236665 19:55068013-55068035 CACAGGAGGGGGAGAGAAAGAGG - Intronic
1168723582 19:58568977-58568999 ACCAGGACTGGGAGAGAATGTGG + Intronic
925793594 2:7519057-7519079 TCCAGGAGCTTGTGAGAAAGAGG + Intergenic
930086550 2:47501754-47501776 TCCAGGAGGTGGAGAGAGAGGGG + Intronic
933198794 2:79424077-79424099 TCCAGGAGGTCAAGAGAGAGAGG + Intronic
933810264 2:86028704-86028726 TCCAGGACCTGGAGAGAGGAAGG + Exonic
935227045 2:101061767-101061789 GGCAGGAAGTGGAGAGCAAGAGG - Intronic
935612244 2:105037820-105037842 TTCAGGACGTGAAGAGAAAGAGG + Intergenic
937535518 2:122882077-122882099 TCCAGGATGTCCAGAGAAAATGG + Intergenic
937899024 2:127002642-127002664 TCCTGCACCTGGAGGGAAAGGGG - Intergenic
938481271 2:131663656-131663678 TCCAGGACGTTGAGAGGCTGAGG - Intergenic
939662296 2:144905022-144905044 TCAAGGACGTGTAGGGAAATGGG + Intergenic
940883858 2:158971579-158971601 TTCATAACGTGGGGAGAAAGGGG - Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942597337 2:177603729-177603751 TCCAGGACGGTAAGAGAATGTGG - Intergenic
942911880 2:181253693-181253715 TCCCGGATGTGGAGACAGAGAGG + Intergenic
943965638 2:194328448-194328470 CCCACAACATGGAGAGAAAGGGG - Intergenic
946193251 2:218018708-218018730 TCTGGGACTTGGATAGAAAGGGG + Intergenic
947355644 2:229292394-229292416 TAGAGGATGTGGAGAAAAAGAGG - Intergenic
948446856 2:238039831-238039853 TCCAGAACATGGAGAGGCAGGGG + Intronic
948799845 2:240427610-240427632 TGCTGGAGGTGCAGAGAAAGAGG - Intergenic
1171970337 20:31560846-31560868 CCCAGGACAAGGAGAGAAGGGGG + Intronic
1172632484 20:36388394-36388416 TCCAGGAGCTGGGGAGGAAGTGG - Intronic
1173303670 20:41827790-41827812 GCCAGCAGGTGGAGAGAAGGAGG + Intergenic
1173908486 20:46646230-46646252 TCCAGGACTAAGAGAGAAGGAGG + Intronic
1175492967 20:59391189-59391211 GCCGGGAGGTGGAGAGACAGGGG + Intergenic
1175505792 20:59483299-59483321 TCCAGGGGCTGGGGAGAAAGTGG + Intergenic
1176260551 20:64177509-64177531 CCCAGGGTGTGGAGAGGAAGAGG + Intronic
1179021163 21:37642320-37642342 TCCAGGATGTTGAAAGAGAGAGG + Intronic
1179046213 21:37847694-37847716 TACAGGACATCGATAGAAAGAGG + Intronic
1179455951 21:41500138-41500160 TCCAGGTCATGGAGAGTGAGTGG - Intronic
1179707677 21:43191662-43191684 GCCAGCACGGGGAGAGGAAGGGG + Intergenic
1181078955 22:20401256-20401278 TCCTGCTCGTGGAGAGAAAGTGG - Exonic
1181142824 22:20819768-20819790 TCCAGGACACGGAGGGAATGAGG + Exonic
1183039351 22:35164948-35164970 TCAGAGACGTGGAGGGAAAGGGG - Intergenic
1183872412 22:40749949-40749971 TCCAGGGAGGAGAGAGAAAGTGG - Intergenic
1184175172 22:42784961-42784983 TCCTGGAGGTGGAGACACAGGGG - Intergenic
1184582857 22:45429072-45429094 TCAGGGACTTGGAGAGAGAGTGG + Intronic
1184608064 22:45585724-45585746 TCCAGGAGGTGGAGGGCATGGGG + Intronic
1185415270 22:50705979-50706001 TCCAGGCGGTGGAGCGCAAGTGG + Intergenic
949907601 3:8871743-8871765 TTCAGGGAGTGGAGAGAGAGAGG - Intronic
950028781 3:9838200-9838222 TCCAGGACCTGGAGCGGGAGAGG + Exonic
950399344 3:12758705-12758727 TCCAGGAAGGGCAGAGAGAGGGG + Intronic
952032662 3:29162969-29162991 TGCAGGACATGGACACAAAGGGG + Intergenic
954036959 3:47856021-47856043 GCTAGGACGGGGAGGGAAAGTGG + Intronic
956312979 3:67902600-67902622 TCTAGGCAGTGGAGAGAAACAGG - Intergenic
957622734 3:82615541-82615563 TCAAGGACATGCAGAGAATGGGG + Intergenic
958646035 3:96875295-96875317 TCCAGGTAGTGCAGAGAAACAGG + Intronic
958993362 3:100873419-100873441 TCCAGGGCAGGGAGGGAAAGGGG + Intronic
960941251 3:122936409-122936431 TGGAGGACGTGGAGATAAACTGG + Intronic
961444849 3:126975201-126975223 GCCAGGAGGAGAAGAGAAAGAGG - Intergenic
962201076 3:133401660-133401682 GCCAGCATCTGGAGAGAAAGAGG - Intronic
962395238 3:135009586-135009608 CCCAGGCCCTGGAGAGACAGAGG + Intronic
966892479 3:184417389-184417411 TCCAGGAAGGGCAGAGGAAGAGG + Intronic
968512085 4:1000245-1000267 TCCAGGAGGTGCAGAGAACCAGG + Intronic
968592026 4:1464100-1464122 TGCAGGACGGGGAGACACAGAGG + Intergenic
969053000 4:4386204-4386226 GCCCGGACGCGGAGAGAAGGGGG - Exonic
969392310 4:6900101-6900123 TCCAGCACTTTGAGAGACAGAGG + Intergenic
969579131 4:8053834-8053856 GGCAGGACGGGGAGAGAAGGCGG - Intronic
969938311 4:10705217-10705239 TGCAGTAAGTGGAGAGAAAGAGG + Intergenic
970315592 4:14825770-14825792 TGCAGGACGTGGAGTGAAGTGGG - Intergenic
974129568 4:57737014-57737036 TCCACAAAGTGGAGAGCAAGAGG + Intergenic
976330797 4:83829028-83829050 TCCAGGAGGTGGAGACCAAGGGG + Intergenic
976645701 4:87385407-87385429 GCCAGGACCTGGGGAGAGAGAGG + Intronic
978036242 4:103998838-103998860 TCCTGGAAGTGGAAAGGAAGGGG + Intergenic
979493839 4:121362342-121362364 TCCAGGAAGAGGGGAAAAAGTGG + Intronic
981089210 4:140715255-140715277 TTCAGGCCGTGATGAGAAAGGGG - Intronic
982110689 4:152050853-152050875 TCCAGGAGGAGGAGGGAAAAAGG + Intergenic
983125785 4:163949462-163949484 TCCACAATGTGGTGAGAAAGGGG + Intronic
984050156 4:174855823-174855845 TCCAGGACAGGGATAGAAAGGGG - Intronic
984819619 4:183869213-183869235 TCCATGACGAGGAAAGAAAATGG + Intronic
984949624 4:184997294-184997316 TCCAAGCCATGGAGGGAAAGAGG + Intergenic
985879679 5:2628765-2628787 TGCAGGGCGTGGAGTGCAAGGGG - Intergenic
986830673 5:11573806-11573828 TGAAGGAGTTGGAGAGAAAGAGG - Intronic
987237312 5:15955888-15955910 TCCAAGAGGTGGTGAGAATGTGG - Intergenic
987607112 5:20151145-20151167 ACCAGGGTGGGGAGAGAAAGGGG - Intronic
988171020 5:27655713-27655735 TCCAGAATTTGGAGAGTAAGTGG - Intergenic
989819322 5:45776243-45776265 TCCAGAAGGTGGAGGGGAAGAGG - Intergenic
992076510 5:73197262-73197284 TTCAGAACGTTGAGAAAAAGTGG + Intergenic
992334844 5:75756088-75756110 TCCAGGGCATGGGGAGAGAGTGG + Intergenic
993418062 5:87660003-87660025 TCCAGGGCGGGGCGGGAAAGGGG + Intergenic
994770366 5:103973802-103973824 TCTAGGATGTGGAGATAAGGGGG - Intergenic
994829520 5:104761163-104761185 TCCAGGAGGTCCAGAGAAACAGG + Intergenic
994851418 5:105058498-105058520 TCAAGGAAATGGAGAGAAATGGG - Intergenic
996743979 5:126829532-126829554 TCAGGAACGAGGAGAGAAAGTGG - Intronic
997751229 5:136347815-136347837 TCCAGGCAGTGGAGAGGAATAGG - Intronic
999160308 5:149490657-149490679 TGCAGGTCCAGGAGAGAAAGGGG - Intergenic
1000082912 5:157864380-157864402 TCCAGCAGGAGGAGAGATAGAGG + Intergenic
1002930264 6:1629518-1629540 TGCAGGCAGTGGAGAGGAAGTGG + Intronic
1003049627 6:2767463-2767485 TCCAGGAACTGGAGTTAAAGGGG - Intronic
1003193692 6:3896189-3896211 TACTGTAGGTGGAGAGAAAGTGG - Intergenic
1003555692 6:7137784-7137806 TCCAGGGCAGGGAGAGGAAGAGG - Intronic
1004688899 6:17975091-17975113 CCCAGAACTTTGAGAGAAAGAGG + Intronic
1005102452 6:22187319-22187341 TCCAGGATGGGGACAGAGAGTGG - Intergenic
1005354185 6:24966981-24967003 TCCAGGATATTGAAAGAAAGTGG - Intronic
1005994029 6:30921050-30921072 TCCACAGCCTGGAGAGAAAGGGG - Exonic
1006155237 6:32010031-32010053 TGTAGGAGGTGGAGGGAAAGAGG + Intergenic
1006161543 6:32042765-32042787 TGTAGGAGGTGGAGGGAAAGAGG + Exonic
1006645740 6:35512878-35512900 TCCTAGACCTGCAGAGAAAGGGG - Exonic
1007108138 6:39297321-39297343 GCCTGGAGGAGGAGAGAAAGGGG - Intergenic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1008787147 6:55182389-55182411 TCCAAGAGCTAGAGAGAAAGTGG - Intronic
1011404760 6:87007335-87007357 TGCAGGGGGTGGAGAGAATGGGG + Intronic
1013744297 6:113326706-113326728 TCCAAGAGGTGGAGAGAAAGGGG - Intergenic
1014270415 6:119330051-119330073 TACAGGATGTGCAGAGTAAGTGG - Intronic
1014763189 6:125380954-125380976 TCCAGGAGGTGGAGAGTTAGAGG + Intergenic
1015698936 6:136013361-136013383 TACAGGATTTGGAAAGAAAGAGG - Intronic
1018647283 6:165960402-165960424 TCCAGGACGAGGAAAGAGACAGG + Intronic
1018725827 6:166612800-166612822 TCAAGGGCATGGAGAGAGAGAGG - Intronic
1018804213 6:167246323-167246345 TCCAGGAGGTGGAGGTAAAAAGG - Intergenic
1019049797 6:169174127-169174149 TTCAGTACCTGGGGAGAAAGTGG + Intergenic
1023723244 7:43116382-43116404 ACCAGGACTTAGAGAGAAAGTGG - Intronic
1024034514 7:45495850-45495872 TTCAGGACATGGTGAGAAAGGGG - Intergenic
1025091404 7:56067097-56067119 TTCAGTAAGTGGAGAGGAAGAGG + Intronic
1025142298 7:56476238-56476260 TTCAGGACTTGGAGAGGATGGGG + Intergenic
1025611119 7:63076454-63076476 TTCAGGACTTGGAGAGGATGGGG - Intergenic
1026722581 7:72844902-72844924 TTCTGCACGTGGAGAAAAAGAGG + Intergenic
1026898749 7:74025830-74025852 TCCAGGACGGGGAGAGAGTCCGG - Intergenic
1027336025 7:77151656-77151678 TCCAGGAGGAGGAGAGGAAAGGG - Intronic
1027473248 7:78598454-78598476 TCCAGGAATTGAAGGGAAAGAGG + Intronic
1028518887 7:91707349-91707371 CCCAGGATGTGGAGAGATAGGGG - Intronic
1028748747 7:94357928-94357950 TTCAGGCACTGGAGAGAAAGGGG - Intergenic
1029100125 7:98122602-98122624 TCCAGGAGCAGGAGACAAAGAGG - Intronic
1030789370 7:113705153-113705175 GCCAGCAGGTGGAGAGACAGGGG - Intergenic
1033177713 7:139140827-139140849 TCAAGGAAATGCAGAGAAAGTGG + Intronic
1035822632 8:2610726-2610748 ACCAGGAGGTAGAGAGCAAGTGG - Intergenic
1036420556 8:8591664-8591686 TCCAGGACTTTGGGAGACAGAGG + Intergenic
1036730255 8:11256611-11256633 GCCAGGATGTGCAGAAAAAGGGG - Intergenic
1037257395 8:16970695-16970717 TGAAGGATGTGGAGAAAAAGTGG + Intergenic
1037481726 8:19312435-19312457 GCCAGGACCTGGAGAGAGACTGG + Intergenic
1041566647 8:59286138-59286160 TCCATGACTTGGAAAAAAAGAGG - Intergenic
1042263353 8:66883138-66883160 TTCAGGAGGTGGAGAGTGAGAGG + Intronic
1042884734 8:73536187-73536209 TCCAAAATGTGGAGAGAAGGAGG + Intronic
1042960941 8:74303176-74303198 TACGGGACATGCAGAGAAAGAGG - Intronic
1043304481 8:78777461-78777483 CCCAGCACCTGGAGAGAAAAAGG - Intronic
1043639702 8:82436254-82436276 CCCAGGAGGTGGAGAGGAGGTGG + Intergenic
1043871075 8:85433690-85433712 ACCAGGGAGTGGGGAGAAAGTGG + Intronic
1044513450 8:93110725-93110747 TCCACAACGTGGAGATAAGGTGG + Intergenic
1044888953 8:96811899-96811921 TGGAGGAAGTGGAAAGAAAGAGG + Intronic
1047145783 8:122197716-122197738 TCCAAGAGGTGAAGAGAAGGAGG + Intergenic
1047352876 8:124092817-124092839 AGCAGGACGAAGAGAGAAAGCGG + Intronic
1048837567 8:138536013-138536035 TCCAGGAGGTGGTGTGCAAGAGG + Intergenic
1049451457 8:142664299-142664321 TCCAGGGTGTGGGGAGAAACAGG + Intronic
1049497118 8:142941279-142941301 ACCAGGATTTGGAGAGGAAGAGG + Intergenic
1049591490 8:143464889-143464911 CCCAGGGCGGGGAGAGAAACAGG + Intronic
1050249686 9:3731648-3731670 TGCATGAGGTGGAGAGAAAATGG + Intergenic
1053191410 9:36073390-36073412 TGCAGGAGGTGATGAGAAAGAGG - Intronic
1054268784 9:62947098-62947120 TCCAGGACTTTGAGAGAACAAGG + Intergenic
1054923257 9:70562917-70562939 TCCAGGGAGGGGAGAGAAATTGG - Intronic
1055625544 9:78173672-78173694 TCAAGGAGGTGAGGAGAAAGAGG - Intergenic
1055757198 9:79570514-79570536 TGCTGGAGGAGGAGAGAAAGGGG - Intergenic
1058191619 9:101923680-101923702 TCTAACAGGTGGAGAGAAAGTGG + Intergenic
1058364110 9:104187533-104187555 TCCAGAAAGAGAAGAGAAAGAGG - Intergenic
1058397968 9:104577847-104577869 TCAAGGAGGTGGAGAAATAGGGG + Intergenic
1060007725 9:120015287-120015309 TCCATGATGCGTAGAGAAAGTGG + Intergenic
1060227682 9:121804591-121804613 GCAAGGATGTGGAGAGAAAAGGG - Intergenic
1061362673 9:130153717-130153739 TCCAGGTCGGGGACAGGAAGTGG - Intergenic
1061860532 9:133465704-133465726 TCCGTGCAGTGGAGAGAAAGTGG + Intronic
1062139313 9:134947221-134947243 TGCAGGACCAGGAGAGAAAGTGG - Intergenic
1062523646 9:136969758-136969780 TCCTGCACTTGGAGAAAAAGAGG + Intronic
1185649118 X:1635916-1635938 TAAAGGAGGAGGAGAGAAAGAGG + Intronic
1187575324 X:20547776-20547798 TCCAGGGCCTGGGGAGAGAGAGG + Intergenic
1189098109 X:38161129-38161151 TACAGGACATGGAGAGACTGAGG + Intronic
1190552596 X:51600004-51600026 TGCAGGACGTGAAAAGAAGGTGG + Intergenic
1190810607 X:53880029-53880051 TCCAGGACTTGCAGAGGATGCGG + Intergenic
1192166464 X:68830125-68830147 TCCAAGACGTGCAGAGGCAGGGG - Intronic
1194838287 X:98708863-98708885 ACCAGGATGTGGAGATAGAGAGG + Intergenic
1196889835 X:120281309-120281331 CCCAGAACGTTGAGAGCAAGGGG - Intronic
1197181087 X:123538124-123538146 TCCAGGAGGAGCAGAGAAAAGGG - Intergenic
1198602092 X:138294977-138294999 TCATGGACGTGGAGAAAGAGAGG - Intergenic
1200794786 Y:7331044-7331066 GCCAGGACATGGGCAGAAAGAGG + Intergenic