ID: 1007637035

View in Genome Browser
Species Human (GRCh38)
Location 6:43305875-43305897
Sequence GTGATAGGGCTCTCTCTCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 108}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007637035_1007637052 30 Left 1007637035 6:43305875-43305897 CCTGAGAGAGAGAGCCCTATCAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1007637052 6:43305928-43305950 AGGCCTAGAGGGAACTTGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 158
1007637035_1007637049 19 Left 1007637035 6:43305875-43305897 CCTGAGAGAGAGAGCCCTATCAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1007637049 6:43305917-43305939 GTGCAGGGTTCAGGCCTAGAGGG 0: 1
1: 0
2: 2
3: 14
4: 186
1007637035_1007637041 -3 Left 1007637035 6:43305875-43305897 CCTGAGAGAGAGAGCCCTATCAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1007637041 6:43305895-43305917 CACCAAAGGCCCTGGGTCTGTGG 0: 1
1: 1
2: 3
3: 30
4: 268
1007637035_1007637048 18 Left 1007637035 6:43305875-43305897 CCTGAGAGAGAGAGCCCTATCAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1007637048 6:43305916-43305938 GGTGCAGGGTTCAGGCCTAGAGG 0: 1
1: 0
2: 0
3: 23
4: 202
1007637035_1007637044 4 Left 1007637035 6:43305875-43305897 CCTGAGAGAGAGAGCCCTATCAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1007637044 6:43305902-43305924 GGCCCTGGGTCTGTGGTGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 369
1007637035_1007637047 10 Left 1007637035 6:43305875-43305897 CCTGAGAGAGAGAGCCCTATCAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1007637047 6:43305908-43305930 GGGTCTGTGGTGCAGGGTTCAGG 0: 1
1: 0
2: 2
3: 40
4: 321
1007637035_1007637038 -10 Left 1007637035 6:43305875-43305897 CCTGAGAGAGAGAGCCCTATCAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1007637038 6:43305888-43305910 GCCCTATCACCAAAGGCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 105
1007637035_1007637050 26 Left 1007637035 6:43305875-43305897 CCTGAGAGAGAGAGCCCTATCAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1007637050 6:43305924-43305946 GTTCAGGCCTAGAGGGAACTTGG 0: 1
1: 0
2: 0
3: 15
4: 139
1007637035_1007637043 3 Left 1007637035 6:43305875-43305897 CCTGAGAGAGAGAGCCCTATCAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1007637043 6:43305901-43305923 AGGCCCTGGGTCTGTGGTGCAGG 0: 1
1: 0
2: 4
3: 43
4: 440
1007637035_1007637051 29 Left 1007637035 6:43305875-43305897 CCTGAGAGAGAGAGCCCTATCAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1007637051 6:43305927-43305949 CAGGCCTAGAGGGAACTTGGTGG 0: 1
1: 0
2: 2
3: 21
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007637035 Original CRISPR GTGATAGGGCTCTCTCTCTC AGG (reversed) Exonic