ID: 1007637641

View in Genome Browser
Species Human (GRCh38)
Location 6:43308729-43308751
Sequence CGGTGAGGCCCGGGCTGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 534}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007637641_1007637647 -5 Left 1007637641 6:43308729-43308751 CCTCCGCAGCCCGGGCCTCACCG 0: 1
1: 0
2: 2
3: 45
4: 534
Right 1007637647 6:43308747-43308769 CACCGAAGAAAACAGGTTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 95
1007637641_1007637650 8 Left 1007637641 6:43308729-43308751 CCTCCGCAGCCCGGGCCTCACCG 0: 1
1: 0
2: 2
3: 45
4: 534
Right 1007637650 6:43308760-43308782 AGGTTGCTGGCAACGCGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 42
1007637641_1007637649 3 Left 1007637641 6:43308729-43308751 CCTCCGCAGCCCGGGCCTCACCG 0: 1
1: 0
2: 2
3: 45
4: 534
Right 1007637649 6:43308755-43308777 AAAACAGGTTGCTGGCAACGCGG 0: 1
1: 0
2: 0
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007637641 Original CRISPR CGGTGAGGCCCGGGCTGCGG AGG (reversed) Exonic
900109480 1:999505-999527 GGGTGAGGCGCGGGCGGCGGCGG - Exonic
900168464 1:1254489-1254511 CCAGGAGGCCCGGCCTGCGGAGG + Intronic
900191767 1:1355139-1355161 GGGGGTGGCCGGGGCTGCGGAGG + Exonic
900483956 1:2912729-2912751 CGGGGAGGCTCTGGCTGCTGGGG - Intergenic
900583582 1:3421518-3421540 CCGTGAGCCCAGGGCTGCGAGGG - Intronic
900619111 1:3578882-3578904 CGCTGGGGGCCGGGCTGAGGAGG - Intronic
901464570 1:9413113-9413135 GGGTGAGGACAGGGCTGCGGGGG - Intergenic
901630657 1:10646690-10646712 CCGTGAGGCCCTGGCTGGCGTGG + Intronic
901641512 1:10695210-10695232 CGGGGACGCGCGGGGTGCGGGGG - Intronic
903227928 1:21904339-21904361 CGCTGAGGCCAGGGCTGGAGAGG + Intronic
903646105 1:24897350-24897372 AGGAGAGGCCGGGGCTGAGGAGG + Intergenic
903860440 1:26361284-26361306 CGGTGAGACCCAGGCAGTGGGGG + Intergenic
904060760 1:27708377-27708399 CAGTGAGGTCCAGGCTGCTGAGG + Intergenic
904618190 1:31761023-31761045 CGGTGCCGCGCGGGCGGCGGGGG + Intronic
904672937 1:32179770-32179792 CGGTGAGGTACGTGCAGCGGCGG + Intronic
905734200 1:40314983-40315005 CGGCCAGGCCCTGGCTGCTGAGG - Intronic
905959946 1:42035502-42035524 GTGTGGGGCCCGGGCTGAGGAGG + Intronic
906055945 1:42917061-42917083 CGGGGAGGCTGGGGCTGCGTGGG + Intergenic
906381480 1:45334751-45334773 CTGTGAGGCCAGGGCTGGGATGG + Intronic
907520357 1:55019719-55019741 CCCTGGGGCCCGGGCTGCTGGGG + Intergenic
910193783 1:84620767-84620789 GGGGCAGGCCCGGGCTGCCGCGG - Intergenic
910445643 1:87296903-87296925 CGGTGGGGCACGGGATGGGGCGG - Intergenic
911091521 1:94021212-94021234 TGGTGAGGCTGGGGCTGTGGTGG + Intronic
912153226 1:106883870-106883892 TAGTGAGGCCCAGGCTGAGGTGG - Intergenic
912625806 1:111204070-111204092 CGGCGAGGCCAGGCCTGAGGGGG - Intronic
913178607 1:116298027-116298049 CGGGGAGGCTGGGGCTGCGTGGG + Intergenic
914375852 1:147073009-147073031 CAGGGAGGCCCAGGCTGCAGTGG + Intergenic
914703023 1:150150610-150150632 CGGCGAGGACGGGGCGGCGGGGG + Intronic
915977567 1:160400868-160400890 GGGTGAGTGCCGGGCCGCGGGGG + Exonic
916940105 1:169668308-169668330 CGGGGAGGCTCGGGCTGCACAGG - Intronic
917291600 1:173477228-173477250 CGCTGGGGGCCGGGCCGCGGGGG - Intergenic
917406192 1:174710932-174710954 CGGGGAGGCTCAGGCTGCGCAGG + Intronic
917445367 1:175102363-175102385 CGGGGAGGCTCGGGCTGCACAGG + Intronic
917796845 1:178538790-178538812 AGGTGGGGCCAGGGCTGCAGAGG - Intronic
918071978 1:181139805-181139827 AGGAGAGGCCCGGGCAGCAGGGG + Intergenic
919070658 1:192751388-192751410 CGGGGAGGCTCGGGCTGCAAGGG - Intergenic
919463254 1:197902969-197902991 CGGAGAGGCCCGGGATGCGCAGG - Intronic
919465947 1:197921681-197921703 CAGGGAGGCCGGGGCTGCGCCGG - Intronic
919861122 1:201740084-201740106 CGGTGAGGCCAGGGGGGTGGGGG - Intronic
920001996 1:202807239-202807261 CGGGGAGGCCTGGGCTGTGCTGG - Intronic
920002258 1:202808015-202808037 CGGGGAGGCCCGAGGCGCGGGGG - Intronic
920194428 1:204217471-204217493 AGGTGAGGCTCGGGATGAGGAGG + Intergenic
920731328 1:208488501-208488523 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
921167750 1:212519073-212519095 CTGTGAGTTCCGGGCTGCAGAGG + Intergenic
921897136 1:220412729-220412751 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
922504709 1:226119756-226119778 AGGGGAGGCCAGGGCTGCTGGGG + Intergenic
922648804 1:227318746-227318768 GAGGGAGGCCCGGGCGGCGGTGG + Intergenic
922740466 1:228011383-228011405 GGGTGAGGCCAGGCCTGCAGAGG - Intronic
922768091 1:228166274-228166296 CGGGGAGGGCCGGGATGGGGTGG + Intronic
922855836 1:228774001-228774023 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
923126686 1:231039994-231040016 CGCGGGGGCCCGGGCGGCGGCGG - Exonic
923193416 1:231642012-231642034 CGGGGAGGCTCGGGCTGCACAGG + Intronic
923540635 1:234885853-234885875 CTCTGAGGCCCGGGCTCTGGGGG + Intergenic
924451402 1:244182127-244182149 CCGTGAGGCCTGAGCTGCCGAGG - Intergenic
1063028632 10:2208647-2208669 AGGGGAGGCCCAGGCTGCTGCGG - Intergenic
1063663610 10:8049563-8049585 CGGTGTGGCCCGCGCAGCCGGGG + Intergenic
1065189367 10:23196170-23196192 CAGGGAGGCCCGAGCTGCGCTGG + Intergenic
1065616923 10:27536468-27536490 CTGGGAGGCCAGGGCTGCAGTGG + Intronic
1068580253 10:58731274-58731296 CAGTGAAGTCCGGGCTGAGGAGG - Intronic
1068863213 10:61867941-61867963 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1068910553 10:62374512-62374534 CGGGGTGGCCGGGGCTGGGGAGG + Intronic
1070641958 10:78176758-78176780 CGGGGAGGCCCAGGCTGCTCAGG + Intergenic
1070906693 10:80079183-80079205 CGGTGAGGCGTGGGGTGGGGCGG + Intronic
1070937924 10:80315698-80315720 TGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1072341803 10:94459557-94459579 CGGGGAGGCTCGGGCCGCGCAGG + Intronic
1073363589 10:102918978-102919000 CGATGATGCCCGAGGTGCGGCGG - Exonic
1074727814 10:116331802-116331824 CTGTGAGGCCCTGGCAGCAGGGG - Intronic
1075802113 10:125160267-125160289 AGGTGAGGCGGGGGCGGCGGCGG + Intronic
1076547340 10:131254134-131254156 CTGTGAGGCCAGGGCTGCCCCGG - Intronic
1076566722 10:131404149-131404171 CAGTGAGGCCAGGGCTGTGGAGG - Intergenic
1076743061 10:132497600-132497622 CGGGGAGGCCCGGACAGGGGCGG + Intergenic
1076868132 10:133179334-133179356 TCCTGAGGCCCGGGCTGTGGTGG + Intronic
1076872319 10:133200122-133200144 CGAGGAGGCCGGGGCTGGGGTGG - Intronic
1077228281 11:1447715-1447737 CGGTGTGGCCCGGGCCCTGGGGG + Intronic
1077330775 11:1982975-1982997 CGGCGGGGCCCAGGCTGGGGGGG + Intronic
1077458187 11:2693518-2693540 GGCTGAGGCCCGGGCTGCTAGGG + Intronic
1077541338 11:3147910-3147932 CGGTGAGGCCAGGGCCATGGTGG - Intronic
1077603273 11:3588977-3588999 CAGAGAGGCTCGGGCTGCGCAGG - Intergenic
1079137965 11:17787026-17787048 CTGTGAGGGCTGGGCTGCAGTGG - Intergenic
1080551465 11:33376570-33376592 CGGTGAGGACCGGGGCGCCGAGG + Intergenic
1080557650 11:33431807-33431829 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1081604780 11:44520413-44520435 GGCTGAGGCCAGGCCTGCGGTGG + Intergenic
1082816727 11:57514419-57514441 CGCTCAGGGCCGGGCTGCTGGGG + Intronic
1083186592 11:61021447-61021469 CGCTGAGCCCAGGGCTGCTGTGG - Intergenic
1083669675 11:64292749-64292771 GGCTGAGGGCCGGGCAGCGGAGG + Exonic
1083741389 11:64713291-64713313 CGGCGAGGCCCGCGCCGCCGAGG - Exonic
1083949427 11:65945873-65945895 CAGGGAGGCCTGGGCTGGGGAGG + Intronic
1084284291 11:68121481-68121503 CGGTGTGGCGAGGGCGGCGGCGG - Intergenic
1084385740 11:68841754-68841776 CGGTGAGGCCCGGTCGCCCGCGG - Exonic
1084831767 11:71774992-71775014 TGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1084979496 11:72821740-72821762 AGGTGAGGCGCGGGCGGGGGCGG + Exonic
1085409389 11:76282333-76282355 CTGTGAGGCCTGTGCTGGGGAGG + Intergenic
1085504071 11:77046122-77046144 AGGTGATGCCGGGGCTGCGCGGG - Intergenic
1085520916 11:77138416-77138438 CGGTGAGGCCCGGGCCAGGAGGG + Intronic
1086001041 11:81986742-81986764 CAGGGAGGCTCGGGCTGCGTGGG + Intergenic
1086064843 11:82733588-82733610 CGATGAGACCGGGGCTCCGGCGG - Exonic
1087175194 11:95089762-95089784 CGGGGCGGCCCGGGCGGCGGGGG - Intergenic
1088332169 11:108665338-108665360 AGGTGAGGCCGGCGCTGGGGAGG + Exonic
1091000996 11:131910778-131910800 CGGCGGGGCAGGGGCTGCGGCGG - Intronic
1202813755 11_KI270721v1_random:38154-38176 CGGCGGGGCCCAGGCTGGGGGGG + Intergenic
1091399307 12:172848-172870 CGGTGGGGCCAGGGATGCAGTGG + Intronic
1091689430 12:2585522-2585544 CTGTGAGGCCGGTGCTGGGGAGG + Intronic
1091823372 12:3492214-3492236 CGGAGAGCCCCCGGCCGCGGGGG + Intronic
1092062592 12:5563600-5563622 TGGAGAGGCCCGGCCTGGGGAGG + Intronic
1092221444 12:6716334-6716356 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1093034541 12:14320391-14320413 CGGGGAGGCTCGGGCTGCCCAGG - Intergenic
1093653867 12:21674070-21674092 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1093741328 12:22693101-22693123 CGGGGAGGCTCGGTCTGCGCGGG + Intergenic
1094199158 12:27779915-27779937 CGGGGAGGCCCGGGAAGCTGCGG - Intergenic
1094564893 12:31590685-31590707 GGGTAAGGCCAGGGCTGCGGCGG - Exonic
1094624064 12:32106618-32106640 CGGTGGGGCGCGCGCGGCGGGGG - Intergenic
1094624173 12:32107017-32107039 CGGCATGGCCCGGGCTGCGGCGG - Intronic
1094743409 12:33315265-33315287 CAGTGAGGTCCAGGCTGAGGTGG - Intergenic
1094815523 12:34179782-34179804 CAGTGAAGCCTGGGCTGAGGAGG - Intergenic
1095937978 12:47705734-47705756 CGCGCAGGCCCGGGTTGCGGGGG + Intronic
1096083855 12:48852063-48852085 TGGTGAGTCCCGGGCGGTGGAGG - Exonic
1097155102 12:57006553-57006575 CGCTGCGGGCCGGGCGGCGGGGG - Intergenic
1097225604 12:57475462-57475484 CAGTGAGGCGCGGGCTGGGGAGG - Exonic
1097270852 12:57772900-57772922 CGGTGAGGAATGGGCTGCGCCGG + Exonic
1098266741 12:68729515-68729537 CGGTGAGGCAGAGGCTGCAGTGG - Intronic
1098759283 12:74403244-74403266 CAGGGAGGCTCGGGCTGCAGAGG - Intergenic
1099222937 12:79935319-79935341 GGGTGTGGCCCAGGCAGCGGGGG + Intronic
1100211841 12:92406581-92406603 CGGGGAGGCTCGGGCCGCAGAGG + Intergenic
1100971847 12:100079338-100079360 CAGTAAGGTCCGGGCTGAGGTGG + Intronic
1101023148 12:100573673-100573695 CCCTGAGGCCCAGGCGGCGGCGG + Intronic
1101605910 12:106247700-106247722 GGGTGCGGCGCGGGCGGCGGCGG + Exonic
1101612203 12:106302521-106302543 TGGTGCGGTCCGGGCTGCCGGGG - Intronic
1102490829 12:113288684-113288706 CGAGGAGGCCGGGGCTGCAGAGG + Intronic
1102904053 12:116660979-116661001 CGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1102954907 12:117053008-117053030 CGGTGAGGTCTGGGCTGGTGTGG - Intronic
1103146102 12:118597239-118597261 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1103518842 12:121524514-121524536 CCTTGAGGCCCTGGCTGCGAAGG - Intronic
1103668590 12:122592321-122592343 CGGGGAGGCTCGGGCTGCACAGG - Intronic
1103985852 12:124767096-124767118 CAGAGAGACCCGGGCTGCTGGGG + Intergenic
1104344535 12:127983682-127983704 CGGGGAGGCTCGGGCCGCGCAGG - Intergenic
1104582679 12:130022352-130022374 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1104614473 12:130256717-130256739 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1104891106 12:132140599-132140621 AGGTGAGGCCCCGGCTGGGCGGG - Exonic
1105217485 13:18297621-18297643 CGGTGGTGGCCGGGCAGCGGCGG + Intergenic
1105512403 13:21061458-21061480 GGGGGAGCCCCGGGCGGCGGCGG + Exonic
1105876641 13:24560769-24560791 CGGAGAGGCTCGGGCTGCACAGG + Intergenic
1106810990 13:33358278-33358300 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1106907654 13:34425469-34425491 CGGTGAGGCCAGGACTGCTCTGG - Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107836157 13:44413872-44413894 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1110609786 13:77475559-77475581 CGGGGAGGCTCGGGCCGCGCAGG + Intergenic
1112402126 13:99086503-99086525 GGGCGCGGCCTGGGCTGCGGCGG - Intronic
1113378593 13:109784654-109784676 GGGTGCGGGCCGGGCGGCGGCGG + Exonic
1113506677 13:110821457-110821479 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1113602238 13:111578148-111578170 CGCTGAGACCGGGGCTGCGGTGG - Intergenic
1113678096 13:112222014-112222036 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1113760373 13:112842378-112842400 TGGTGAGAGCCGGGCTGGGGAGG + Exonic
1115651134 14:35403853-35403875 CAGGGAGGCGCGGGCTGCGGGGG + Intronic
1115985863 14:39103170-39103192 CGCTGAGGCCCGGGGCGGGGTGG - Exonic
1116250996 14:42482456-42482478 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1117176776 14:53153362-53153384 CGGTGCAGCCCGGGCTTCCGGGG - Intergenic
1118604321 14:67491877-67491899 AGGAGAGGCCCAGGCCGCGGGGG + Intronic
1118796704 14:69151764-69151786 CGGGGAGGCCCGGGCCCCGCGGG - Intronic
1118971594 14:70642214-70642236 CTGTGCGTCCCGGGCGGCGGCGG + Exonic
1119673409 14:76536814-76536836 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1121020805 14:90579019-90579041 CAGGGAGGCCAGGGCTGCAGAGG - Intronic
1121122566 14:91385239-91385261 TGTTGGGGCCCTGGCTGCGGTGG - Intronic
1122145054 14:99684121-99684143 GGGTGGGGCCTGGGCTGGGGCGG + Intergenic
1122514573 14:102297986-102298008 CGGGGAGGCTTGGGCTGCGCAGG - Intronic
1122688225 14:103520019-103520041 CGGTGTGGACACGGCTGCGGTGG - Exonic
1122945710 14:105007953-105007975 CGGAAAGGGCCGGGCTGGGGTGG - Intronic
1123110746 14:105865911-105865933 CAGAGAGGCCCGGGTGGCGGTGG + Intergenic
1123684249 15:22786425-22786447 CGGTGAGGCGCTGGGTGGGGCGG - Intronic
1124120383 15:26883556-26883578 CGGTGAGCGCCGGGCGGGGGCGG + Exonic
1125476984 15:40054350-40054372 CGCAGAGGCCCAGGCTGAGGGGG + Intergenic
1125609739 15:40961915-40961937 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1125730442 15:41890030-41890052 AGGTGAGGCCAGGGCTGGGCTGG + Intronic
1125793902 15:42390172-42390194 GGGTAAGGCCCTGGCTGCTGAGG - Intronic
1126736558 15:51737276-51737298 CGGTGCGGCTCGGGGTGCGGTGG - Intronic
1126929427 15:53631641-53631663 CGGTGAAGGCCAGGCTGAGGAGG + Intronic
1127225116 15:56919378-56919400 CGGGGACGTCCGGGCGGCGGCGG + Intronic
1128669940 15:69567421-69567443 CGGGGAGGCTCGGGCTGCATAGG + Intergenic
1129158227 15:73732248-73732270 CGGGGAGGCTCGGGCCGCGCAGG + Intergenic
1129226851 15:74175127-74175149 CAGAGAGGCCAGGGCTCCGGCGG - Exonic
1129828307 15:78650249-78650271 AGCTGAGGCCCAGGCTGCAGTGG + Intronic
1129901149 15:79150359-79150381 CAGTGAGGTCCAGGCTGAGGTGG - Intergenic
1130517018 15:84633532-84633554 CGGCCCGGCCCAGGCTGCGGAGG - Intergenic
1130550729 15:84888671-84888693 CGGTGAGACCCTGGCTGAGGAGG - Intronic
1132372632 15:101308972-101308994 TGGTGAGGAGCGCGCTGCGGTGG + Intronic
1132646452 16:1001356-1001378 AGCTGAGGGCCTGGCTGCGGGGG + Intergenic
1132689774 16:1177282-1177304 GGCTGAGGCCCGGGCAGCAGGGG - Intronic
1132721631 16:1319349-1319371 CGGTGTGGGACGGTCTGCGGTGG + Intronic
1132837189 16:1959933-1959955 AGGTGAGGTCCGGGGTGCAGTGG - Intronic
1132871264 16:2116746-2116768 CGGTGGAGCCTGGGCTGAGGAGG - Intronic
1132887579 16:2189398-2189420 TGGTGAGGCCCGAGCGGGGGCGG - Exonic
1132897741 16:2236959-2236981 AGGTGGGGCCCGGGCCGGGGCGG + Exonic
1132903733 16:2271815-2271837 GGGTCAGGCCCGGGGAGCGGGGG - Intergenic
1133283787 16:4681277-4681299 GGTTGAGGCCAGGGCTGGGGCGG + Intronic
1134008496 16:10834233-10834255 TGGTGTGGCCCGGGCTGGAGAGG - Intergenic
1134521262 16:14920148-14920170 CGGTGGAGCCTGGGCTGAGGAGG + Intronic
1134708937 16:16318799-16318821 CGGTGGAGCCTGGGCTGAGGAGG + Intergenic
1134716147 16:16358833-16358855 CGGTGGAGCCTGGGCTGAGGAGG + Intergenic
1134950668 16:18349846-18349868 CGGTGGAGCCTGGGCTGAGGAGG - Intergenic
1134958606 16:18393326-18393348 CGGTGGAGCCTGGGCTGAGGAGG - Intergenic
1135382864 16:22008538-22008560 AGGGGAGACCCGGGCCGCGGAGG + Intronic
1135392139 16:22102816-22102838 CGGTGAGGGCAGGTCTGTGGAGG - Intronic
1135607348 16:23836086-23836108 CGGGGAGGCGCGGGAGGCGGCGG - Exonic
1136029042 16:27489555-27489577 CGGCCAGGACTGGGCTGCGGTGG - Intronic
1136033603 16:27521186-27521208 GGGTGAGGGCCTGGCAGCGGAGG - Intronic
1136365376 16:29806909-29806931 CGCGGCGGCCCGGGCTGGGGGGG + Intronic
1136498116 16:30656158-30656180 CCGTGGGGTCCGGGCTGCAGGGG + Exonic
1136642297 16:31577193-31577215 CAGTGAGGTCCAGGCTGAGGTGG + Intergenic
1137454846 16:48610193-48610215 CGGCGGGGCCCGGCCCGCGGCGG - Exonic
1137707935 16:50548343-50548365 CGGGGAGGCGCGGGCCGCGGCGG + Exonic
1139826659 16:69762481-69762503 CGGCGCGGCCCGGGCGTCGGGGG + Intronic
1140891287 16:79287381-79287403 CGGTGAGGCGGGGGCTGGCGGGG + Intergenic
1141431258 16:83971335-83971357 GGGTGTGGCCCGGGCTGAGGAGG + Intronic
1141930051 16:87196260-87196282 CTGTGAGGCCAGGTCTGCGAGGG - Intronic
1142139742 16:88467614-88467636 CTGCGAGGCCCGGGGTCCGGAGG - Intronic
1142167802 16:88602153-88602175 AGGTGAGGCCCTGCCTGCAGCGG - Intronic
1142220857 16:88854288-88854310 AGGTGTGGACAGGGCTGCGGAGG + Intronic
1142511775 17:400474-400496 CGTTGAGGCCCAGGCTGGAGTGG - Intergenic
1142592535 17:1012618-1012640 CTGGGGGGCCCGGGCTGGGGGGG + Intronic
1142990075 17:3724367-3724389 CGCTGAGGTCCGGGCTGAGGCGG - Exonic
1143030494 17:3964537-3964559 CGGTGCGCCCCGGGGCGCGGAGG - Intergenic
1143461458 17:7107059-7107081 CGGGAAGGCCTGGGCTGAGGCGG - Exonic
1143498144 17:7324087-7324109 GGGTGAGGGCCGGGCTGGGCTGG - Exonic
1144656904 17:17042658-17042680 CTGTGAGGCCCGGGCGGCTCAGG + Intronic
1145750010 17:27349052-27349074 CGCTGGGGCGCGGGCGGCGGTGG + Intergenic
1146009218 17:29180292-29180314 CGGTGAGTGCCGGTCGGCGGCGG - Exonic
1146182996 17:30709226-30709248 CGAGGAGGCCCCGGCTGAGGGGG + Intergenic
1147110333 17:38257023-38257045 CGGCGAGGCCCAGGCTGTGGAGG + Intergenic
1147317480 17:39627703-39627725 CAGTGAGGCTGGGGGTGCGGGGG + Intronic
1147720405 17:42536341-42536363 CGACGAGGCCCGGGAGGCGGCGG + Exonic
1147971538 17:44220993-44221015 CGGGGTGGCCCGGGAGGCGGCGG - Intronic
1148021806 17:44558226-44558248 CCGGGTGGCCCGGGCGGCGGCGG + Exonic
1148157145 17:45431008-45431030 CGGTGCGGGCCGGGCTGGGCGGG - Intronic
1148419177 17:47531408-47531430 CGGCGAGGCCCAGGCTGTGGAGG - Exonic
1148789630 17:50166099-50166121 CGGGGAGGCCCAGGATGAGGGGG + Intronic
1150373354 17:64661282-64661304 GTGTGTGGCCCGGGCAGCGGTGG + Intronic
1150778319 17:68099579-68099601 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1151700646 17:75740850-75740872 CGGTGAGTCCCGGGGTGCCCGGG + Exonic
1151727833 17:75894824-75894846 CGGTGGTGGCCAGGCTGCGGGGG + Intronic
1152105784 17:78328058-78328080 CAGTGAGGCCTGGGCTGTGAAGG - Intergenic
1152519292 17:80845936-80845958 CGGTGAGGGCCCGGCAGTGGAGG - Intronic
1152525583 17:80886652-80886674 TGGTGTGGCCCTGGCTGCTGAGG + Intronic
1152594315 17:81230812-81230834 CGGTGAGGACAGGGCTGTGGTGG - Intronic
1152619003 17:81352096-81352118 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1152679186 17:81656883-81656905 GGGTGAGGGCCAGGCTGCAGAGG - Intronic
1152718603 17:81911552-81911574 CGGTGGGGCGCGGCCTTCGGGGG - Intergenic
1152874017 17:82775445-82775467 AGGTAAGGCCAGGGCTGCGAGGG + Intronic
1152879741 17:82808261-82808283 CGGGGAGGCCCCTGCTGTGGAGG + Intronic
1152879819 17:82808505-82808527 CGGGGAGGCCCCTGCTGTGGAGG + Intronic
1153479021 18:5528670-5528692 CTGGGAGGCCTAGGCTGCGGTGG - Intronic
1153868753 18:9297237-9297259 CGGGGAGGCTCAGGCTGCGAGGG - Intergenic
1154942931 18:21132599-21132621 CAGGGAGGCTCGGGCTGCGCAGG + Intergenic
1155152786 18:23135856-23135878 GGCTGAGGCTGGGGCTGCGGCGG - Exonic
1155821250 18:30380685-30380707 CAGTGAAGTCCGGGCTGAGGTGG - Intergenic
1157776740 18:50402081-50402103 CGCAGAGGCCCGGCCTGCTGTGG + Intergenic
1158896278 18:61916601-61916623 AGGTGAGGCCAGGGGTGGGGAGG + Intergenic
1158920609 18:62187396-62187418 TGGTCAGGCCGGGGCTGTGGAGG + Exonic
1160163171 18:76491179-76491201 CGGCGTGGACCGGGCTCCGGGGG - Intronic
1160209771 18:76867110-76867132 CGGAGAGGAGCGGGCTGCGAGGG + Intronic
1160453370 18:78979877-78979899 GGGTGCGGCGCGGGCCGCGGTGG - Intergenic
1160703222 19:518027-518049 AGGGGAGGCCCAGGCTGAGGGGG + Intronic
1160736089 19:663026-663048 CGGTGAGGCCCGGGCCGGGGCGG - Exonic
1160763564 19:797561-797583 CGGGGAGGCCGGCGCGGCGGCGG - Intronic
1160779646 19:872136-872158 CGGTGTGGCTGGGGCGGCGGGGG + Intronic
1160781615 19:880005-880027 CGGCGGGGCCCGCGGTGCGGGGG + Exonic
1160784488 19:893065-893087 AGGTGAGTGCGGGGCTGCGGGGG - Exonic
1160838939 19:1137483-1137505 GGGGGAGGCTCGGGCTGGGGGGG + Intronic
1161074895 19:2280814-2280836 CAGGGAGCCCTGGGCTGCGGGGG - Intronic
1161099964 19:2416603-2416625 CGGTGAAGATCGGGCTGCGGCGG + Exonic
1161264802 19:3359373-3359395 AGGGGAGGCCCGGGGAGCGGCGG - Intergenic
1161264828 19:3359433-3359455 CGCCGCGGCCCCGGCTGCGGCGG - Intergenic
1161322039 19:3645824-3645846 GGATGAGGCCCGGTCTGAGGGGG + Intronic
1161617836 19:5282020-5282042 TGGGGACGCCCAGGCTGCGGTGG - Intronic
1161849297 19:6730593-6730615 GGGTGGGGCCAGGGCTGCTGGGG - Intronic
1161978705 19:7619726-7619748 CGGTGAGGGCCCGGCTGGGGCGG - Exonic
1162135807 19:8554633-8554655 CGGTGAGGCTGGGGCTGGGTGGG - Exonic
1162344227 19:10110401-10110423 TGGTGAGGCCGGGGCCGCCGGGG + Exonic
1162909182 19:13840298-13840320 CAGTGAGGGCCTGGCTGTGGGGG + Intergenic
1163102582 19:15107344-15107366 CGGGGAGGCCCGGGCGGGGCGGG + Intergenic
1163138708 19:15332134-15332156 CGGGGAGGCCGGGGCTACGCGGG - Intronic
1163146127 19:15380160-15380182 CGTCGAGGCCCGGGATGCCGCGG + Exonic
1163181685 19:15608708-15608730 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1163218890 19:15899981-15900003 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1163666420 19:18606080-18606102 CGGGGAGGGCGGGGCTGCAGGGG - Intronic
1164644061 19:29845089-29845111 GGGTGGGGCCAGGGCGGCGGTGG + Intergenic
1164834730 19:31349774-31349796 CGCCGAGCCCCGGGCCGCGGCGG - Intergenic
1165846626 19:38821794-38821816 CGGGGAGGCTCGGGCTGTGCAGG - Intronic
1165914203 19:39247903-39247925 CGGTGAGGCCCGGGAGTGGGCGG - Intergenic
1166089984 19:40502506-40502528 AGGTGAGGCCGGGGATGCAGGGG + Exonic
1166389627 19:42401841-42401863 CGGGGAGACGGGGGCTGCGGGGG - Exonic
1166686213 19:44797925-44797947 CAGTGAGGCTGGGGCTGCTGTGG + Intronic
1166731281 19:45060466-45060488 CGGTGAGGTCTGGGCTGGAGTGG + Exonic
1166852358 19:45766832-45766854 CCCTGAGGGCTGGGCTGCGGTGG + Exonic
1167300239 19:48673647-48673669 CGGGGACCCCCGGGGTGCGGGGG + Intergenic
1167499116 19:49835739-49835761 CCCTGAGGCTGGGGCTGCGGTGG - Exonic
1168314131 19:55476721-55476743 AGGTGGGGCCCCGGCAGCGGCGG - Exonic
1168339311 19:55614468-55614490 AGGTGGGGGCCGGGCTGGGGCGG - Exonic
925376372 2:3388689-3388711 AGAGGAGGCACGGGCTGCGGAGG - Intronic
926120707 2:10239891-10239913 CGATGAGGCCCTGTCTGCGCTGG - Intergenic
926161730 2:10494532-10494554 CGGGGAGGCCAGGGCTGGGGCGG + Intergenic
926268117 2:11344475-11344497 CGGGGCGGTCCGGGCCGCGGCGG - Exonic
929109899 2:38397560-38397582 CGGGGAGGCTCGGGCGGCGCAGG - Intergenic
929233750 2:39585653-39585675 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
929650583 2:43676501-43676523 GGGTGGGGTCCGGGCTGCTGCGG + Intronic
930730687 2:54724988-54725010 CGCCGAGGCTGGGGCTGCGGCGG - Exonic
931756954 2:65383040-65383062 CGGTGGTGACCGGGCTGCGTGGG - Intronic
931867969 2:66432468-66432490 CGGTGAGGCGTGGGGTGGGGGGG + Intergenic
932178320 2:69622338-69622360 CGGGGAGGCTCCGGCTGCGCAGG - Intronic
932496309 2:72147473-72147495 TGGGGAAGCCCGGGCTGCTGCGG + Intronic
933133460 2:78701794-78701816 TGGTGAGGCCGGGGGGGCGGGGG + Intergenic
933506353 2:83181297-83181319 CGGGGAGGCTCGGGCTGCGCAGG - Intergenic
934296820 2:91749030-91749052 CGGTGGTGGCCGGGCCGCGGCGG - Intergenic
934754755 2:96817116-96817138 CGGCGCGGCCCGGGCGGCTGCGG + Exonic
936091963 2:109507259-109507281 CTGTGAGGCCCGGCCAGGGGTGG - Intergenic
936433264 2:112482232-112482254 CGGCGGGGGCCGGGCCGCGGCGG + Exonic
937044322 2:118843264-118843286 CGGAGAGGGCCGGGGTGGGGTGG + Intronic
937083775 2:119157916-119157938 CGGGGCGGCCCGGGCTGCCAGGG - Exonic
939241862 2:139571926-139571948 CGGTGAAGGCCAGGCTGAGGAGG + Intergenic
943645938 2:190408210-190408232 CTGTGAGGCCGGGGCCGGGGAGG + Intergenic
945080874 2:206085519-206085541 CGCGGAGGCCCGGGGTGCGGGGG + Intronic
946311276 2:218883746-218883768 TGGAGGGGCCCGGGCGGCGGTGG - Intronic
946339519 2:219058813-219058835 CTGTGAGGCCCGGGCTCTGCAGG - Intronic
946982125 2:225229512-225229534 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
947962083 2:234247971-234247993 CGGGGAGGCTCGGGCAGCGCAGG - Intergenic
948468679 2:238164095-238164117 AGTTCAGGCCCGGGCCGCGGCGG - Exonic
948764356 2:240211934-240211956 CAGTAAGGCCAGGGCTGGGGAGG + Intergenic
948826167 2:240574347-240574369 CGGTGCGGCCAGGGCCGGGGAGG + Exonic
948990114 2:241549641-241549663 CGTTCAGGCCGAGGCTGCGGAGG + Intergenic
1168795901 20:610074-610096 CGGCGCGGCCCGGGCCCCGGGGG - Exonic
1169065488 20:2692627-2692649 CGGCCGGGCCCGGGCCGCGGCGG - Intergenic
1169171824 20:3471341-3471363 CTGTGAGGCCGAGGCCGCGGCGG + Exonic
1171123099 20:22582372-22582394 CTGTGAGGCCTGGGCTCCGGCGG + Exonic
1171430646 20:25081574-25081596 CGCTGGGGCCAGGGGTGCGGTGG + Intronic
1171818797 20:29813522-29813544 CAGTGAAGCCCGGGCTGAGGAGG - Intergenic
1172083286 20:32358858-32358880 CCGTGGGGCCCGGGGTGGGGGGG + Intronic
1172771580 20:37385388-37385410 CGCTGGGGCCCGGGCAGCAGAGG - Intronic
1173250142 20:41360082-41360104 CAGTGGGGCCCGTGCTGCTGTGG + Exonic
1174317474 20:49713790-49713812 CCGCGAGGCCCGGGAGGCGGTGG - Exonic
1175921618 20:62452937-62452959 GGGTGTGGCTGGGGCTGCGGAGG + Intergenic
1176179373 20:63742234-63742256 CGGCGGGGCCTGGGGTGCGGCGG + Intronic
1176238717 20:64066080-64066102 GGGTGTGGCCCTGGCTGCTGGGG + Intronic
1176414675 21:6467689-6467711 CGGAGGGTCCCAGGCTGCGGCGG - Intergenic
1178351004 21:31873250-31873272 CGGCGAGGCGGAGGCTGCGGAGG + Intergenic
1178581596 21:33843013-33843035 AGGAAAGGCCTGGGCTGCGGTGG + Intronic
1178585605 21:33868380-33868402 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1178983311 21:37283248-37283270 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1178992483 21:37367205-37367227 CGCCGGGGCCCGGGCGGCGGCGG - Intronic
1178992578 21:37367527-37367549 CGGGGCGGCGCTGGCTGCGGAGG + Intronic
1179176668 21:39012552-39012574 CGGTGAGCTCCGGGCTTCTGAGG - Intergenic
1179242138 21:39601931-39601953 TGGTGAGGCCTGGGCTGGGGTGG + Intronic
1179690175 21:43076011-43076033 CGGAGGGTCCCAGGCTGCGGCGG - Intronic
1179810323 21:43865570-43865592 CGGGGAGGCCGGGGTTGCGGGGG - Intronic
1180225473 21:46389430-46389452 AGGTGAGGCCCAGGCTCCCGGGG + Exonic
1180322767 22:11338211-11338233 CAGTGAAGCCCGGGCTGAGGAGG - Intergenic
1181028910 22:20140707-20140729 CGGTGAGGCCCGGCCTGGGCAGG + Exonic
1182337998 22:29598128-29598150 CGGGGAGGCTCCGGCTGCGCAGG + Intergenic
1182353283 22:29710728-29710750 AGGTGAGGCCAGGGCTCTGGTGG + Intergenic
1183422077 22:37717902-37717924 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1184342087 22:43891667-43891689 CGGTGAGTCCCGGACCGCGGGGG - Exonic
1184712748 22:46262831-46262853 CGGGGAGACGCGGGCCGCGGGGG + Exonic
1184785451 22:46669400-46669422 CGGTGAGGACCGGGCTGTGCCGG + Intronic
1184890280 22:47375078-47375100 CGTTGTGGCCGGGGCTGGGGTGG - Intergenic
1185029318 22:48433342-48433364 GGGTGAGGCCCGGGGTGGGGAGG - Intergenic
1185229078 22:49670264-49670286 CGGGGAGGCTCGGGCCGCGCAGG + Intergenic
1185313577 22:50169724-50169746 GGGTGGGGCCGGGGCTGCAGTGG + Intergenic
1185313787 22:50170352-50170374 GGGCGGGGGCCGGGCTGCGGCGG + Intergenic
949259018 3:2083925-2083947 CGGGGAGGCCCGGGCCGCACAGG - Intergenic
950107654 3:10398514-10398536 CCGTGAAGCCTGGGCTGCTGGGG - Intronic
951013798 3:17706204-17706226 CGGCGAGGCCCAGGCTGTGGAGG + Intronic
951551514 3:23879661-23879683 CAGGGAGGCCTGGGCCGCGGCGG + Intronic
953025972 3:39145158-39145180 TGGTGAAGCCCTGGCAGCGGGGG + Exonic
953485050 3:43286854-43286876 ACGCGGGGCCCGGGCTGCGGTGG + Intronic
953627284 3:44581184-44581206 CTGTGAGGCCCGGGCGGCTCAGG - Intronic
954297152 3:49680638-49680660 CGGTGGGTCCCAGGCTGTGGAGG + Intronic
955449521 3:59051155-59051177 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
956178989 3:66500574-66500596 CGGAGCGGCCCGGGCACCGGGGG - Exonic
956632639 3:71331395-71331417 CGGGGAGGCTTGGGCTGCGCAGG - Intronic
961402038 3:126654636-126654658 CCGCGGGTCCCGGGCTGCGGCGG - Intronic
961460504 3:127046975-127046997 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
961734664 3:128993909-128993931 GGAAGAGTCCCGGGCTGCGGCGG + Intronic
961956996 3:130814872-130814894 CGGGGAGGCTCGGGCTGCGCGGG + Intergenic
962398713 3:135039491-135039513 CGGGGAGGCTCGGGCTGCACAGG + Intronic
962520839 3:136196175-136196197 CGGTAGGGCCCGGGCTGCTGCGG + Intronic
963236796 3:142963868-142963890 CGGGGCGGCCCGGGCTGCGGCGG - Intergenic
963440449 3:145333676-145333698 CGGGGAGGCTCGGGCCGCAGAGG - Intergenic
964200314 3:154111603-154111625 CTGTGAAGCCTGGGCTGAGGTGG - Intergenic
965470526 3:169084944-169084966 CAGTATGGCCAGGGCTGCGGCGG - Exonic
965521221 3:169669388-169669410 CGGGGAGGCGCGGGTTGGGGTGG + Intergenic
968081573 3:195849918-195849940 CGCTGAGGCCGGGGCTGCGCTGG - Intergenic
968181551 3:196599099-196599121 CGGGGAGGCCCGGGCCGCACAGG + Intergenic
968514724 4:1011376-1011398 CGGCGAGGCTCGGGTTGGGGCGG + Intronic
968739967 4:2322461-2322483 CGGTGTGGCCAGGGGTGTGGGGG + Intronic
968741349 4:2333183-2333205 AGGGGAGGCCAGTGCTGCGGGGG - Intronic
969339106 4:6529324-6529346 AGGAGAGGCCAGGGCTGCAGGGG - Intronic
971030819 4:22635045-22635067 CGGTGAGGCGCGGTCCGCGCGGG - Intergenic
971481519 4:27118871-27118893 CTGTGAGGGCTGGGCTGTGGGGG - Intergenic
972022748 4:34335703-34335725 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
973144226 4:46804892-46804914 CGGGGAGGCTCAGGCTGCGTGGG + Intronic
973257500 4:48128048-48128070 CTGTGGGGCCCGGGCTGCGCGGG + Intronic
976406421 4:84664989-84665011 CGGGGAGGCTCGGGCTGCACGGG - Intergenic
976520588 4:86021669-86021691 CGGGGAGGCTCGGGCTGCACAGG + Intronic
977717307 4:100196582-100196604 CGGCGAGGCTCGGGCTGCACAGG + Intergenic
977906519 4:102483424-102483446 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
979522127 4:121679604-121679626 CGGAGAGGGCCTGGCTGCTGTGG - Intronic
979523832 4:121697086-121697108 CGCTGAGGCCGGGGCAGGGGCGG - Exonic
980051888 4:128047621-128047643 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
981136239 4:141213845-141213867 CGGGGAGGCTAGGGCTGCGTGGG - Intergenic
982768976 4:159378390-159378412 CAGGGAGGCTCGGGCTGCGTGGG - Intergenic
984241802 4:177227627-177227649 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
984265702 4:177495890-177495912 CCGGGAGGCCCGGGCTGCACAGG - Intergenic
984662290 4:182386848-182386870 CGGGGAGGCTCGGGCTGCACAGG - Intronic
985195072 4:187420684-187420706 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
985412068 4:189695754-189695776 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
985541464 5:489403-489425 GGCTGAGGCTCGGGCTGAGGAGG + Intronic
985560450 5:583487-583509 GAGTGAGGGCAGGGCTGCGGGGG + Intergenic
985590923 5:764657-764679 TGGGGAGGCTCGGGCTGCGCAGG - Intronic
986194546 5:5526221-5526243 CAGTGAAGCCCTGGCTGAGGTGG + Intergenic
987383968 5:17311835-17311857 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
987990209 5:25200085-25200107 CGGGGAGGCTCGGGCTGCGCAGG + Intergenic
988142558 5:27262966-27262988 CAGTGAGGTCCAGGCTGTGGAGG + Intergenic
988532123 5:32037020-32037042 CGGTGAGACGCGTGCTGAGGAGG + Intronic
990490108 5:56295623-56295645 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
990825423 5:59893348-59893370 CGGGCAGCCCCGGGCGGCGGCGG + Exonic
992487429 5:77210388-77210410 CAGTGGGGCCCGGGCGGCTGCGG + Intergenic
994254754 5:97580056-97580078 CGGGGAGGCTCGGGCTGCTCAGG + Intergenic
994935321 5:106246509-106246531 CGGGGAGGCTCGGGCTGCATAGG - Intergenic
995679830 5:114704350-114704372 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
995759051 5:115544601-115544623 CAGGGCGGCCCGGGCGGCGGTGG - Exonic
997302223 5:132814151-132814173 CGGTGGGGCCGCGTCTGCGGAGG - Exonic
997583501 5:135031442-135031464 GCGGGAGGCACGGGCTGCGGCGG - Exonic
997718330 5:136058524-136058546 CGATGAGGTCAGGGCTGAGGGGG - Intronic
998103163 5:139451038-139451060 CTCTGAGGCCAGGGCTGGGGTGG - Intronic
999753420 5:154647109-154647131 CCCGGAGGCCCGGGCTGAGGAGG + Intergenic
1000329146 5:160193958-160193980 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1000609177 5:163356112-163356134 TGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1000889288 5:166784603-166784625 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1002026278 5:176397909-176397931 GGGTGAGGGCGGGGCTGAGGCGG - Exonic
1002076695 5:176712663-176712685 AGCTGAGGCCTGGGCTGCTGAGG + Intergenic
1002131044 5:177081968-177081990 GGGCCAGGCCCGGGCTGCAGTGG + Intergenic
1002221786 5:177688533-177688555 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1002487745 5:179550945-179550967 CGGTGGGGGCCGGGCTGGGAGGG + Intronic
1002521739 5:179796180-179796202 CCGTGGGGCCAGGGTTGCGGCGG + Intronic
1002559472 5:180071767-180071789 GGGCGCGGCCCGGGCGGCGGCGG + Exonic
1003531417 6:6940388-6940410 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1003624066 6:7726951-7726973 CGGGGATGCCGGGGCTGGGGCGG + Exonic
1004053109 6:12108451-12108473 CGGGGAGGCTTGGGCTGCGCAGG + Intronic
1004228921 6:13813994-13814016 AGGTGAGGCCCGGGCGGGAGAGG - Exonic
1004663354 6:17729053-17729075 CGGGGAGGCTCGGGCCGCGCAGG - Intergenic
1005327860 6:24720193-24720215 CCGTGAGTCCCGGGCTCCGCGGG - Exonic
1005707404 6:28469415-28469437 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1005712046 6:28512085-28512107 CGGGGAGGCTCGGGCCGCGCAGG - Intronic
1005749039 6:28866545-28866567 CGGGGAGGCTCGGGCCGCGCAGG + Intergenic
1005758853 6:28949855-28949877 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1005915261 6:30345533-30345555 AGGTGAGGCCCGGGACGAGGAGG - Exonic
1005947741 6:30606543-30606565 GGCTGAGACCCGGGCTGAGGAGG - Exonic
1006337404 6:33427892-33427914 CGGCGGGGCCCGGGCAACGGCGG + Intronic
1006388815 6:33746908-33746930 CCGGGAGGGCCGGGCTGCCGTGG + Exonic
1007637641 6:43308729-43308751 CGGTGAGGCCCGGGCTGCGGAGG - Exonic
1007820956 6:44560187-44560209 ACGTGAGGCCCGGGGTGCCGTGG - Intergenic
1008038829 6:46774897-46774919 CGGGGAGGCCAGGGCTGCACAGG - Intergenic
1008844877 6:55950606-55950628 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1009510770 6:64547787-64547809 CGGGGCGGCTCGGGCTGCGCAGG + Intronic
1009800754 6:68533689-68533711 CGGGGAGGCTCGGGCTGTGCAGG - Intergenic
1011449045 6:87473298-87473320 CTGACAGGCCGGGGCTGCGGCGG + Intronic
1012410136 6:98947658-98947680 CGGGGAGGGGCGGGCAGCGGGGG + Intronic
1014272566 6:119349925-119349947 CGGCGGGGCCCGGCCGGCGGCGG + Intergenic
1014586343 6:123202256-123202278 TGGGGAGGCTCGGGCTGCGCGGG - Intergenic
1015600390 6:134905029-134905051 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1016010755 6:139135516-139135538 CGGGGGGGCCCTGGCGGCGGCGG + Exonic
1017839453 6:158209812-158209834 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1017879109 6:158547580-158547602 CGCTGAGGCCCCAGCTGAGGGGG - Intronic
1018624603 6:165765348-165765370 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1018849718 6:167578242-167578264 CGGGGAGGCCAGGGCCGTGGCGG + Intergenic
1019190604 6:170248644-170248666 CGGTGTGGGTCGGGCTGCAGAGG - Intergenic
1019308241 7:346594-346616 GCGTGAGCCCCGGGCGGCGGCGG - Intergenic
1019308250 7:346628-346650 GTGTGAGCCCCGGGCGGCGGCGG - Intergenic
1019308261 7:346662-346684 GTGTGAGCCCCGGGCGGCGGCGG - Intergenic
1019308280 7:346729-346751 GTGTGAGCCCCGGGCGGCGGCGG - Intergenic
1019393388 7:802450-802472 CCGTGAGGCCCCGGGTGGGGAGG + Intergenic
1019464549 7:1180182-1180204 CCGTGAGACCCTGGGTGCGGAGG + Intergenic
1019536164 7:1530915-1530937 CAGCGGGGCCCGGGCCGCGGCGG + Intronic
1019554101 7:1620012-1620034 CCCTGAGGCCCGGGCGGGGGCGG - Intergenic
1019563580 7:1669360-1669382 CGGGGACGCGCGGGCTGCGCGGG + Intergenic
1020163956 7:5793792-5793814 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1020255976 7:6503415-6503437 CGCTGTGGCCAGGGCTGCTGGGG - Intronic
1020278198 7:6637220-6637242 CGGGGAAGCGCGGGTTGCGGGGG - Intergenic
1021452772 7:20798047-20798069 CCGCAAGGCCCGGGCTGCGGCGG + Intergenic
1023000942 7:35807256-35807278 CGGGGAGGCGGAGGCTGCGGTGG - Intronic
1024691326 7:51806133-51806155 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1025174043 7:56787758-56787780 CGGAGGGGACCGGGCCGCGGGGG - Intergenic
1025698058 7:63790197-63790219 CGGAGGGGACCGGGCCGCGGGGG + Intergenic
1026335935 7:69394125-69394147 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1027778990 7:82499869-82499891 CGGGGAGGCTCGGGCTGTGCAGG - Intergenic
1028585549 7:92447835-92447857 CGGGGCGGCGCGGGCAGCGGGGG + Exonic
1029510569 7:100992219-100992241 CTGTGGGGCCTGGGCTGCTGTGG - Exonic
1029567549 7:101348874-101348896 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1030102095 7:105955871-105955893 CGGGGAGGCTCAGGCTGCGCAGG + Intronic
1030138737 7:106284673-106284695 GGGGGAGGCGCGGGCGGCGGCGG - Intronic
1031051879 7:116953432-116953454 CGGGGGCGCCCGGGCCGCGGCGG + Exonic
1031483177 7:122302010-122302032 TGGTGGAGCCCGGGCTGCAGGGG + Exonic
1031605495 7:123763277-123763299 CAGGGAGGCTCGGGCTGCGCAGG + Intergenic
1031899333 7:127392454-127392476 TGGTGGGACCCGGGTTGCGGCGG - Exonic
1032085922 7:128883981-128884003 CGGTGAGTCCAGGGATGTGGGGG - Exonic
1034618181 7:152436273-152436295 CCGTCAGGCCCGGGCGGCGGCGG + Intergenic
1034972343 7:155427169-155427191 CGGTGAGGCCCAGTCAGCAGTGG - Intergenic
1034977711 7:155457887-155457909 CGGGGACGGCCGGGCGGCGGCGG + Intergenic
1035158610 7:156934625-156934647 CTGGGAGGCCTGGGCTGCAGGGG + Intergenic
1035187763 7:157139337-157139359 AGGTGAGGGCCGGGCTGGCGGGG + Exonic
1035475833 7:159143925-159143947 CGGCGACGCCCGGTCTGCAGCGG - Intronic
1035573216 8:687826-687848 CGGAGAGGCCCCGGATGCAGCGG + Intronic
1035754373 8:2020858-2020880 AGGAGAGTCCCGGGCTGCGCAGG - Intergenic
1035833949 8:2728096-2728118 GGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1037674417 8:21041518-21041540 CAGTGTGGCCGGGGCTGCTGAGG + Intergenic
1038540349 8:28385868-28385890 CTGGGAGGCCGGGGCCGCGGCGG - Intronic
1040003652 8:42600118-42600140 CGGGGAGGCTCGGGCTGCACGGG + Intergenic
1040275661 8:46012443-46012465 CTGTGTGGCCCGGGTTGGGGGGG - Intergenic
1041636627 8:60153029-60153051 CGGGGAGGCTCGGGCTGCGCAGG + Intergenic
1041919797 8:63168826-63168848 GGGAGAGGCCCAGGCAGCGGCGG + Exonic
1042512530 8:69626546-69626568 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1042948719 8:74179593-74179615 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1043435366 8:80232106-80232128 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1044459608 8:92429290-92429312 CGGGGAGGCTCAGGCTGCGTGGG + Intergenic
1045277487 8:100721328-100721350 CCATGAGGCTCGGGCGGCGGCGG - Intronic
1045467721 8:102485575-102485597 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1045743304 8:105387393-105387415 CGGGGAGGCTCCGGCTGCGCAGG + Intronic
1047277357 8:123416447-123416469 GGGTGGGGCCCGGGATGGGGCGG - Intergenic
1049087596 8:140490577-140490599 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1049425081 8:142534351-142534373 GAGTGAGGCCCAGGCCGCGGAGG - Intronic
1049557340 8:143289561-143289583 GGGAGAGGCCCGGGCGGAGGAGG + Intergenic
1049643815 8:143727357-143727379 GGGCGCGGCCGGGGCTGCGGCGG - Exonic
1049860434 8:144894493-144894515 GGGTGAGGCCAGGGCTGCTGCGG - Intronic
1050540992 9:6670017-6670039 CAGTGAGCCCCTGGCTGGGGTGG - Intergenic
1051463837 9:17354233-17354255 CGGGGAGGCTCGGGCTGCACAGG - Intronic
1051641948 9:19231183-19231205 TGGTGGGGGCCGGGGTGCGGAGG + Intronic
1052300418 9:26947109-26947131 CGGAGAGCGCCGGGCCGCGGCGG + Exonic
1053547874 9:39042419-39042441 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1055651412 9:78410293-78410315 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1055654977 9:78442372-78442394 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1057273555 9:93664319-93664341 GGGTGAGGCAAGGGGTGCGGAGG + Intronic
1057300738 9:93880202-93880224 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1057511172 9:95680629-95680651 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1057933991 9:99221647-99221669 CCGCGAGGCCTGGGCTGGGGCGG - Exonic
1058786536 9:108393812-108393834 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1060296533 9:122347152-122347174 CGGAGCGGCCCGGGCGGCCGGGG + Intergenic
1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG + Exonic
1061261722 9:129483894-129483916 CTGTGGGGCCAGGGCTGGGGAGG + Intergenic
1061487964 9:130929812-130929834 CGGTGAGGTCGGGGCAGCGCGGG + Exonic
1061675084 9:132211085-132211107 TGGTGAACCCCGGGCTGCTGCGG - Intronic
1061681057 9:132242611-132242633 CGGTGAGGCCTGGGGTCTGGTGG - Exonic
1061922064 9:133787835-133787857 GGGTGGGGCCAGGGCTGCAGGGG - Intronic
1062415232 9:136445599-136445621 TGGGGAGGCCTGGGCTGCGGGGG + Intronic
1062503025 9:136859316-136859338 GGGTGAGCCCTGGGCTGCAGTGG + Exonic
1062566079 9:137164561-137164583 CAGTGCGGCCAGGGCTGCTGGGG + Intronic
1062574560 9:137200209-137200231 CGGGGCGGCGCGGGCGGCGGCGG + Exonic
1203772819 EBV:58121-58143 CGCGGAGGCCGGGGCCGCGGAGG + Intergenic
1203772826 EBV:58136-58158 CGCGGAGGCCGGGGCCGCGGAGG + Intergenic
1203772833 EBV:58151-58173 CGCGGAGGCCGGGGCCGCGGAGG + Intergenic
1203772840 EBV:58166-58188 CGCGGAGGCCGGGGCCGCGGAGG + Intergenic
1203670526 Un_KI270755v1:7227-7249 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1187005806 X:15231793-15231815 TGGTGAGGCTCGGGCTGCATGGG + Intergenic
1188189566 X:27157301-27157323 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1188440974 X:30215267-30215289 CTGTGAGGCCCAGGCAGGGGTGG + Intergenic
1188445017 X:30246899-30246921 CTGTGAGGCCCAGGCAGGGGTGG + Intronic
1190413927 X:50163393-50163415 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1192630805 X:72776903-72776925 CGGGAAGACCCGGGCGGCGGAGG + Intergenic
1192650905 X:72943901-72943923 CGGGAAGACCCGGGCGGCGGAGG - Intergenic
1193271104 X:79530881-79530903 CGGGGAGGCTCAGGCTGCGCAGG - Intergenic
1193804001 X:85972421-85972443 CGGGGAGGCTCGGGCTGCACAGG + Intronic
1194421059 X:93673387-93673409 GGCGGAGGCCCGGGCTGCGGAGG + Exonic
1194890451 X:99372134-99372156 CGGGGAGGCTCAGGCTGCGCAGG + Intergenic
1195160832 X:102169176-102169198 CAGTGAGGCTCGGGGTGGGGGGG - Intergenic
1195285246 X:103376939-103376961 CGGAAAGGGCCGGGCGGCGGCGG + Intronic
1195896329 X:109749396-109749418 CGGCGAGGCTCGGGCTGCACAGG + Intergenic
1196705873 X:118716999-118717021 CGGGGAGGCTCGGGCTGCACAGG + Intergenic
1196775550 X:119333893-119333915 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1197340089 X:125255945-125255967 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1197719077 X:129732631-129732653 CGGTGAAGTCCAGGCTGCTGAGG + Intergenic
1199175576 X:144783916-144783938 CGGGGAGGCTCGGGCTGCACAGG - Intergenic
1200032556 X:153307971-153307993 TGGTTAGGCCAGGGCTGTGGAGG - Intergenic
1200115621 X:153768574-153768596 TGGTGAAGGCCGGGCTGCAGGGG - Intronic
1200144814 X:153921076-153921098 CGGTGAGGAAAGGGCTGGGGAGG - Exonic
1200216545 X:154370596-154370618 CGCGGAGGCGCGGCCTGCGGAGG + Intronic
1201487105 Y:14505948-14505970 CGGGGAGGCTCGGGCTGCACAGG - Intergenic