ID: 1007643317

View in Genome Browser
Species Human (GRCh38)
Location 6:43361210-43361232
Sequence TTTTCCCTCTGATTTTCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1067
Summary {0: 1, 1: 0, 2: 9, 3: 109, 4: 948}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007643317_1007643320 9 Left 1007643317 6:43361210-43361232 CCTAAAGAAAATCAGAGGGAAAA 0: 1
1: 0
2: 9
3: 109
4: 948
Right 1007643320 6:43361242-43361264 TCCTTCAATCTGTCAGAATAAGG 0: 1
1: 0
2: 1
3: 16
4: 164
1007643317_1007643322 22 Left 1007643317 6:43361210-43361232 CCTAAAGAAAATCAGAGGGAAAA 0: 1
1: 0
2: 9
3: 109
4: 948
Right 1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007643317 Original CRISPR TTTTCCCTCTGATTTTCTTT AGG (reversed) Intronic
900475445 1:2874309-2874331 TTTTCCCTTTTATTTTCTTCAGG - Intergenic
900927918 1:5717697-5717719 TTTTCCCTTGGATTTTCCTCTGG + Intergenic
901130226 1:6957932-6957954 TTCTCTCTCTGATTTCCTGTAGG - Intronic
901468641 1:9440336-9440358 TTTTCCCTTGAATATTCTTTGGG + Intergenic
901777138 1:11567970-11567992 TTTTCCTTTTCTTTTTCTTTTGG + Intergenic
903255076 1:22091936-22091958 TTTTCCCTCCTCTTTTTTTTGGG + Exonic
903818777 1:26084893-26084915 TTTTCTCTCTCTCTTTCTTTTGG - Intergenic
904823389 1:33259052-33259074 TTTTCAGTCTGACATTCTTTGGG - Intronic
905208493 1:36357037-36357059 TTTTCCCTTTGTTTTATTTTAGG + Intronic
905252530 1:36658841-36658863 TTTGCCCTCTGGTTTTCTGTGGG + Intergenic
905425683 1:37882252-37882274 GTTTCCCTGTGACTTTCTTCTGG - Intronic
905813232 1:40928515-40928537 TCTTCCCTCTGATTTTCAGATGG + Intergenic
905836599 1:41128842-41128864 TTTTCTCTCTGTGTTTCATTTGG + Intronic
905982675 1:42244675-42244697 TTTTGTTTCTGATTTTATTTGGG - Intronic
907172733 1:52484843-52484865 TTTTCCATCAGATTTTCATGTGG + Intronic
907184323 1:52598238-52598260 TTTCCTCTCTGACATTCTTTAGG + Intergenic
907765191 1:57403037-57403059 TTCCCACTCTGATTTTCCTTTGG + Intronic
908396453 1:63729671-63729693 TTTTGGCTCTAATTTTCTTTTGG - Intergenic
908803891 1:67909687-67909709 TTGTCTCTCTGATTTTCTAAAGG + Intergenic
908812733 1:68000541-68000563 TCTTCCTTTTGATCTTCTTTGGG + Intergenic
909339138 1:74511993-74512015 TCTTCCTTCCGATTTTCCTTGGG - Intronic
909460486 1:75907765-75907787 TTTTCCCTCTGACTATATCTTGG + Intronic
909557938 1:76975649-76975671 TTTTGTGTCTGCTTTTCTTTTGG - Intronic
909660453 1:78076219-78076241 CTTTCCCCCTAATTTTCCTTTGG - Intronic
909984413 1:82143016-82143038 TTTTCCTTCTTTTTTTTTTTTGG + Intergenic
910033829 1:82766192-82766214 CTTCTCCTCTGATTTTATTTAGG - Intergenic
910081685 1:83349498-83349520 CTTTCTGTCTCATTTTCTTTTGG - Intergenic
910305677 1:85760506-85760528 ATTTCCCTCAGCTTTTCATTGGG - Intronic
910434967 1:87196865-87196887 TTTTTCTTCTAATGTTCTTTGGG + Intergenic
911164688 1:94714193-94714215 TTCTCTCTCTGATTTTCTGGTGG + Intergenic
911280158 1:95915303-95915325 TTTTCTCTCTCTTATTCTTTGGG - Intergenic
911291270 1:96059286-96059308 TTCTCACTCTGCTTTTCTCTTGG + Intergenic
911316043 1:96358211-96358233 ATTTCTCTATGATTTTCTCTTGG + Intergenic
911330503 1:96520742-96520764 TTTCCCCTCTGATCTTCCTCTGG - Intergenic
911500877 1:98682909-98682931 TTTTCCATCTCTTGTTCTTTTGG + Intronic
911901991 1:103518072-103518094 TTTGTTTTCTGATTTTCTTTTGG + Intergenic
911975808 1:104493237-104493259 TTTAATCTCTGATTTTATTTGGG - Intergenic
911978075 1:104528195-104528217 TATTCCATCTTGTTTTCTTTGGG - Intergenic
912078051 1:105902158-105902180 TTTTGCTTCTGATTTTCATTTGG - Intergenic
912093777 1:106114396-106114418 TTTTCCCACTGATGTTCATCAGG - Intergenic
912119067 1:106446767-106446789 TTTCCTCTCATATTTTCTTTTGG + Intergenic
912316784 1:108674821-108674843 TTTTGTCTCTGATTTTATTTGGG - Intergenic
912793008 1:112672050-112672072 AACTCCCTCTGGTTTTCTTTTGG - Intergenic
912884511 1:113455947-113455969 TTTTCTCTCTCTTTTTTTTTTGG + Intronic
912971297 1:114286126-114286148 TTCTCCCTCTGAATTCCTCTAGG + Intergenic
913289655 1:117260308-117260330 ATTTCCCTCTCATTGTCCTTTGG - Intergenic
913338866 1:117736387-117736409 TTTTCCCCTAGATTTTCTTCTGG + Intergenic
914801683 1:150967010-150967032 CTGTCCCTTTGGTTTTCTTTGGG - Intronic
915075515 1:153305476-153305498 TTTTTCTTCAGATTCTCTTTAGG + Intronic
915089174 1:153410704-153410726 TTTTCCCACTGATATTCATCAGG - Intergenic
915733650 1:158071157-158071179 TTTTCTCTCTGGATTTCTGTCGG + Intronic
915819936 1:159012064-159012086 TTTTCACTCTTCTTATCTTTTGG + Intronic
916314703 1:163436442-163436464 TTTTCTCTCTTTTTTTTTTTTGG + Intergenic
916706405 1:167355529-167355551 TTTTCTCTCTGTCTTTTTTTTGG - Intronic
917011281 1:170475289-170475311 GTTTCCATCTGATATTCCTTTGG - Intergenic
917014419 1:170513247-170513269 TTTGCCCTCTGACTTCCTGTTGG + Intergenic
917326238 1:173835547-173835569 TTTTCCATTTTTTTTTCTTTAGG - Intronic
917463445 1:175253009-175253031 TCTTCCCTCAGATTTTATCTGGG + Intergenic
917467886 1:175299365-175299387 TTTTCAATCTGACTTTTTTTAGG + Intergenic
917546161 1:175970656-175970678 TTTTTCCTATAATTTTCTTAAGG + Intronic
917986269 1:180322712-180322734 TTTCATCTCTGATTTTATTTGGG + Intronic
918128585 1:181605507-181605529 TTTTTCCTGTGTTTCTCTTTTGG - Intronic
918537506 1:185590109-185590131 TTTTCCCATTGATGTTCATTAGG - Intergenic
918571243 1:185995809-185995831 TCTTCCCCCTGATTTTCATGTGG - Intronic
918758406 1:188368291-188368313 TTTTCTTTCTGATCTTCTCTTGG - Intergenic
918952909 1:191163000-191163022 TGTTACCTGTTATTTTCTTTCGG - Intergenic
919054792 1:192556543-192556565 TTTTCCCTCTGTGTTCCATTTGG - Intergenic
920572359 1:207027249-207027271 TTTTTCCGCCGATTTTCATTAGG - Intronic
920647840 1:207816285-207816307 TCCTCCCTTTGATTTTCTTTAGG - Intergenic
921026308 1:211286270-211286292 CTTTCCCTCTGTGTTTGTTTGGG + Intronic
921074527 1:211689029-211689051 TTTTCCCTTTTTTTTTCCTTAGG - Intergenic
921209254 1:212878735-212878757 TTTTCTCTATGAAGTTCTTTTGG - Intronic
921345531 1:214180386-214180408 TTTTCCCTCTGTGTTTCATTTGG - Intergenic
921561702 1:216666938-216666960 TTCTTCCACTGATTTTTTTTGGG - Intronic
921674042 1:217957368-217957390 TTTTCCCTCTGGCTTTTTTCAGG - Intergenic
922090351 1:222389787-222389809 TTTTCCCTCTAAATTACTTAAGG - Intergenic
922631253 1:227114185-227114207 CTTTCCCTCTGATTTCTTTACGG - Intronic
922903714 1:229157907-229157929 TTTTCCCCTTGATTGTCTCTTGG - Intergenic
922956506 1:229605963-229605985 TTTTCCCTTTGTTTTTTATTGGG + Intronic
923335100 1:232961530-232961552 TCTTCCCATTTATTTTCTTTGGG + Intronic
923526731 1:234778616-234778638 TTTTCCCCCAGATTATCTTGGGG - Intergenic
923540853 1:234887070-234887092 TTTTCCCTTTTATTTTGGTTGGG + Intergenic
924041364 1:239987429-239987451 TTTTCACTCTGATAGTATTTTGG + Intergenic
924439698 1:244075912-244075934 TTTTCTCTCTGATCTCTTTTAGG - Intergenic
924642026 1:245843080-245843102 TTTTCTCTCTCATGTTCTTTGGG + Intronic
924693803 1:246379006-246379028 TTTTCTTTCTCATTTTCTCTGGG - Intronic
924693907 1:246380420-246380442 TTTTCTTTCTCATTTTCTCTGGG - Intronic
1063118216 10:3085963-3085985 TGTTCCCTCTGCCTTTTTTTGGG + Intronic
1063496413 10:6513304-6513326 TTTTGCTTTTGATTTTATTTTGG - Intronic
1064457126 10:15498284-15498306 TTCTCCCTCTAATTTGTTTTGGG + Intergenic
1064521284 10:16204779-16204801 TTTCACCTGTGATTTTATTTGGG + Intergenic
1065980754 10:30894219-30894241 TTTCCCTTTTTATTTTCTTTTGG - Intronic
1066015223 10:31234440-31234462 TTTTCCATCTCTTTTTCTTCCGG - Intergenic
1066471235 10:35700356-35700378 TTTTTCTTCTAACTTTCTTTCGG - Intergenic
1067722172 10:48736414-48736436 TTTTCTGTCCAATTTTCTTTAGG + Intronic
1067817391 10:49491740-49491762 TTATTCCTTTCATTTTCTTTTGG - Intronic
1067840495 10:49673422-49673444 TTTTGTTTCTGATTTTATTTGGG - Intergenic
1068117101 10:52747452-52747474 TTTGCTCTGTGATTTTCATTGGG + Intergenic
1068257393 10:54531039-54531061 TCTTCCCTTTGATTTACATTTGG - Intronic
1068377603 10:56204233-56204255 TTTACTTTCTGTTTTTCTTTTGG - Intergenic
1068898523 10:62236526-62236548 GTTTCCCTTTTAATTTCTTTAGG - Intronic
1069016396 10:63433901-63433923 TTTTCCCTTTTTTTTTTTTTTGG - Intronic
1069059140 10:63875433-63875455 TTTTCCCACTGGCTTTCTTAAGG + Intergenic
1069099322 10:64298754-64298776 TTTTCCCTTCAATTTTCATTTGG + Intergenic
1069242505 10:66161037-66161059 TTTTCCCACACCTTTTCTTTAGG + Intronic
1069382680 10:67856880-67856902 TTTTAAATTTGATTTTCTTTGGG + Intergenic
1070171472 10:73936227-73936249 TTTTCCTCCTGATTTTTGTTTGG + Intergenic
1070222749 10:74467718-74467740 TTTTCCTTATGAATTTTTTTGGG - Intronic
1070359031 10:75669298-75669320 TTTTCCCTATGAGGTTCTCTGGG + Intronic
1070493317 10:76998024-76998046 CTTCCCCTCTGAAGTTCTTTTGG + Intronic
1070548294 10:77470080-77470102 TTTGCTCTCTGAGGTTCTTTTGG + Intronic
1070654322 10:78260956-78260978 TTTCCTCTCTGACTTACTTTAGG - Intergenic
1071171860 10:82875669-82875691 TTTACACTTTGATTTTCTGTTGG + Intronic
1071304885 10:84290514-84290536 TTATCTCTCAGAGTTTCTTTGGG - Intergenic
1071353699 10:84771802-84771824 TCTCTCCTTTGATTTTCTTTTGG - Intergenic
1071749694 10:88460755-88460777 CTTTCCCTCTGACTGTTTTTGGG + Intronic
1071787883 10:88923096-88923118 TTTACCATATGATTTTCTTTAGG - Intronic
1071935234 10:90522719-90522741 TTTTATCCCTGATTTTATTTGGG + Intergenic
1072744806 10:97932607-97932629 TTTTCCCACTGATGTTCTCCAGG - Intronic
1072849660 10:98875029-98875051 TTTTCACACTGATGTTCATTAGG + Intronic
1072989121 10:100173550-100173572 TTTTACCCCTGCTTTTTTTTGGG - Intronic
1073385039 10:103119369-103119391 TATACCCTCTGACTTTTTTTTGG - Intronic
1073527802 10:104201272-104201294 TATTTCCACTGGTTTTCTTTTGG + Intronic
1073588499 10:104733695-104733717 TTTTCCCTCAGCTTTCCTCTGGG + Intronic
1073669137 10:105567891-105567913 TTTTCTCTCTGAATTTCTCTGGG + Intergenic
1073946198 10:108753478-108753500 ATTTTCCTCTTATTTGCTTTTGG - Intergenic
1074198937 10:111215033-111215055 TTTTCTCGTAGATTTTCTTTTGG + Intergenic
1074256815 10:111811273-111811295 TTTTCCTTCTGAGTTTTCTTTGG + Intergenic
1074547544 10:114412940-114412962 TTGTCCCTCTGCTTCTCTTCAGG + Intergenic
1074599537 10:114899730-114899752 ATAGCCCCCTGATTTTCTTTGGG - Intronic
1074673832 10:115826219-115826241 GTTTCCCTCTGAATTTCTCTTGG + Intronic
1074768058 10:116715060-116715082 TTTTCCTTGTGATTATCTTTAGG - Intronic
1074831166 10:117250470-117250492 TTTTCTTTTTAATTTTCTTTGGG - Intronic
1074853176 10:117455023-117455045 GTTTCCTTATCATTTTCTTTTGG + Intergenic
1075134863 10:119775122-119775144 TCTTCACTCAGATTCTCTTTAGG + Intronic
1075523564 10:123162210-123162232 TTTTTCCTCTGGTTCTCTCTTGG + Intronic
1076263443 10:129090488-129090510 TTTTCTCTCTGTGATTCTTTGGG + Intergenic
1077912293 11:6583254-6583276 TTTTTCATCTGATTTTGTTTGGG - Intronic
1078290159 11:10002024-10002046 TTTTTCCTCTGTTTTTTTTATGG - Intronic
1078628901 11:12983807-12983829 TTTGCCCTCTGGTTCCCTTTGGG + Intergenic
1078651165 11:13194368-13194390 TTTTCCATCTGCTTTTCATATGG - Intergenic
1079379506 11:19925364-19925386 TTTGCCCTATGTTTTCCTTTAGG + Intronic
1079544860 11:21620939-21620961 TTTTCCCACTTATTTTCACTTGG + Intergenic
1079595983 11:22247073-22247095 TTTTCCCTCTGTATTTTGTTTGG - Intronic
1079929772 11:26543323-26543345 TGTTCCCTCCCATTTTCTTCTGG - Intronic
1079938755 11:26651537-26651559 TTCTCACTATGTTTTTCTTTTGG + Intronic
1079943160 11:26707510-26707532 TTGTCTCTCTGTTATTCTTTAGG + Intronic
1079946274 11:26745681-26745703 TTTTCTCTTTGGTTATCTTTAGG - Intergenic
1080480702 11:32646839-32646861 TTTTCCATCTTTTTGTCTTTTGG + Intronic
1080646134 11:34189270-34189292 TTTTCTCTTTTCTTTTCTTTTGG - Intronic
1080671559 11:34384105-34384127 TTTCCCCTCTGACTTCCTCTTGG + Intergenic
1080955502 11:37089864-37089886 TTTTCCCTCTATTTTTATATGGG + Intergenic
1080985201 11:37455078-37455100 TTTTCCCTGTGTTATTCTTGTGG - Intergenic
1080989864 11:37519008-37519030 TTTCATCTCTGATTTTATTTTGG - Intergenic
1081134933 11:39428866-39428888 TTGACTCTCTGATTTCCTTTTGG + Intergenic
1081244948 11:40754070-40754092 TTTTTCAGTTGATTTTCTTTGGG + Intronic
1081439742 11:43066782-43066804 TCTTGCCTCTGATATTCTTGAGG - Intergenic
1081460422 11:43267666-43267688 TTTTCTCTCTTTTTTTTTTTTGG - Intergenic
1081930327 11:46865844-46865866 ATTACTCTCGGATTTTCTTTAGG - Intronic
1082096215 11:48131880-48131902 TTTTCATTCTCATTCTCTTTTGG + Intronic
1082111587 11:48282208-48282230 ATTTCCTTCTGATTTAATTTGGG + Intergenic
1082715720 11:56610751-56610773 TTTTCCTTCTGCATGTCTTTGGG - Intergenic
1082874683 11:57976439-57976461 TTTTCCCTATGATTAGATTTAGG + Intergenic
1082900746 11:58248440-58248462 TTTTCTCTCTCATTTTCTTTGGG - Intergenic
1083388609 11:62331848-62331870 TTTTCCATCTTATTTCATTTTGG + Intergenic
1084132324 11:67145756-67145778 TATGCCCTCTTATTTACTTTTGG + Intronic
1085033628 11:73287464-73287486 GCTGCCCTCTGATTTTCCTTTGG - Intronic
1085147666 11:74216760-74216782 TTTTTCATCTGATTTTATTTGGG - Intronic
1085478260 11:76801426-76801448 TTTTCCCTCTGAAAGCCTTTTGG - Intergenic
1085748859 11:79141278-79141300 TTTCATCTCTGATTTTATTTGGG - Intronic
1085893147 11:80604994-80605016 TTTTCCCCCTGCTGTTCTTGTGG - Intergenic
1085948383 11:81299892-81299914 ATTTCCTTCTGATTTCCTTATGG + Intergenic
1086204961 11:84246865-84246887 TATTGCCGCTGATTTTTTTTTGG + Intronic
1086224138 11:84487115-84487137 TTTTCCCATAGTTTTTCTTTTGG - Intronic
1086428344 11:86710197-86710219 TTTTCCCTCCATTTTTATTTTGG - Intergenic
1086909157 11:92451999-92452021 TTTTCTCTGAAATTTTCTTTGGG + Intronic
1086926167 11:92642870-92642892 TTTTCTGTCAGATTTTCTGTGGG - Intronic
1087134216 11:94698902-94698924 TTTTCCCTGTGGGCTTCTTTTGG - Intergenic
1087183992 11:95167208-95167230 GATTCTCTCTGATATTCTTTCGG + Exonic
1087366224 11:97223020-97223042 TATTCTCTGTGATTTTCCTTAGG - Intergenic
1087518377 11:99197538-99197560 TTTTCCCACTCCTTTTCTTCAGG + Intronic
1087619486 11:100525673-100525695 TCTTAGCTCTGATTTTCCTTGGG - Intergenic
1087913165 11:103776833-103776855 TTTTCCCTATGTTTTTCTCTAGG + Intergenic
1088138687 11:106589385-106589407 TTATTTCTCTTATTTTCTTTGGG + Intergenic
1088226841 11:107629892-107629914 CTTTCCCTCTGCTTTCCCTTAGG - Intronic
1088448368 11:109955722-109955744 TTGTCACTTTGATTTTCTTCTGG - Intergenic
1088533447 11:110835511-110835533 TCTTTCCTCTGCATTTCTTTGGG - Intergenic
1088925181 11:114294769-114294791 TTCTCCCTCTCTTTTTTTTTCGG - Intronic
1088999341 11:115038011-115038033 TTCTCCCACTCATTTTCTCTTGG + Intergenic
1089319443 11:117614967-117614989 TGTGCCCTCTGATTATCTATTGG - Intronic
1089371294 11:117960704-117960726 TTTCCTCTCTCATTTGCTTTAGG - Intergenic
1089578094 11:119460752-119460774 TTTTCCCACTGACTTCCATTAGG - Intergenic
1089734735 11:120542350-120542372 TTTTCCCTATGTTTTCTTTTAGG - Intronic
1089859817 11:121579156-121579178 TTTTTTCTCTGATTTTCTTCCGG + Intronic
1089886973 11:121835577-121835599 CTTTGTCTCTGATTTTATTTGGG - Intergenic
1089976810 11:122739438-122739460 ATTTCTCTCTGAGGTTCTTTTGG + Intronic
1089994110 11:122888569-122888591 TTTTCTCTGTAATTTTCTATAGG - Intronic
1090633127 11:128668203-128668225 TTCTCCATCTGCTTTTCTCTGGG + Intergenic
1091333074 11:134745815-134745837 TTTTCCTTCTCAATCTCTTTGGG - Intergenic
1091837279 12:3594788-3594810 TTTTCACTGTGTTTTTCTCTAGG - Intergenic
1092265147 12:6975207-6975229 TTTTCTCTCTTTTTTACTTTAGG + Exonic
1092308692 12:7328307-7328329 TTTTCCCAGTGATTGTCTTTGGG - Exonic
1092585200 12:9892998-9893020 TTTCCCCTATGTTTTCCTTTAGG + Exonic
1093044206 12:14423549-14423571 TTTTCTTTCTCATTTTCTTCAGG + Intronic
1093061429 12:14611201-14611223 TTTTCTCTCTCATCTTCTTTAGG + Intergenic
1093097156 12:14984523-14984545 TTTGCCCTCTGATTTCCAGTTGG - Intergenic
1093103936 12:15062898-15062920 TTTTGTTTCTGATTTTATTTGGG + Intergenic
1093298724 12:17426421-17426443 TTTTATCTTTGTTTTTCTTTAGG + Intergenic
1093423747 12:19004260-19004282 ATTTACCTCTGATCTTCTCTTGG - Intergenic
1093586158 12:20839560-20839582 TTTTCCCTCTGGTTTCTTTTGGG + Intronic
1093785863 12:23191373-23191395 TTTTCTATCTGCTTTTCTTTAGG - Intergenic
1093864502 12:24208776-24208798 TCTTCCCTCTGCTTTTCACTTGG - Intergenic
1093938499 12:25027023-25027045 TTTTCCTTCTTTTTTTTTTTTGG + Intronic
1093941603 12:25061147-25061169 TTTTCCCTTTCCTTTTCTTGAGG + Intronic
1094104254 12:26793050-26793072 GTTCCCCTCTGACTTTCATTGGG + Intronic
1094131151 12:27076827-27076849 TTGCCATTCTGATTTTCTTTTGG + Intergenic
1094345460 12:29463465-29463487 ATTTCCCTCTATTTTTCTTGTGG - Intronic
1094483653 12:30905997-30906019 TTTTCCCTTTCACCTTCTTTAGG - Intergenic
1094590943 12:31819569-31819591 TCTTACCTCTTATTGTCTTTAGG - Intergenic
1095614210 12:44169476-44169498 TTGTCCATCTGTTTATCTTTTGG + Intronic
1096065798 12:48739120-48739142 TTTTTCCTATGAGTTTATTTTGG + Intergenic
1096446253 12:51695097-51695119 TTTGCCTTCTCATTTTCTCTTGG + Intronic
1097454116 12:59774952-59774974 TCTTCGTTTTGATTTTCTTTGGG - Exonic
1097524467 12:60713063-60713085 TTTTCCCTCTGTTTATCTTTTGG - Intergenic
1097627623 12:62020287-62020309 TATTCCCTCTGTGTTTCTGTGGG - Intronic
1097629772 12:62045980-62046002 TTTTCCCTCAGAATTTCTTTTGG - Intronic
1097661320 12:62434798-62434820 TTTTCCCTCTCTTTTTTTTTCGG + Intergenic
1097733678 12:63157480-63157502 ATTTGCCTCTATTTTTCTTTAGG + Intergenic
1098584025 12:72135094-72135116 GTTTTCATCTGATTTTCTGTTGG - Intronic
1099559918 12:84159546-84159568 TTTTCTCTCTGACTTTGTTTAGG + Intergenic
1099756899 12:86863095-86863117 TTTTCCCTCTTATTAATTTTAGG - Intergenic
1100905183 12:99290053-99290075 TTTCACCTCTGATTGTATTTAGG - Intronic
1100945100 12:99774048-99774070 TTTTCCCTATGTTTTCTTTTAGG - Intronic
1101025849 12:100605355-100605377 TTTCATCTCTGATTTTATTTGGG + Intronic
1101050990 12:100864015-100864037 TTTTCCATCTGTTTTCCTCTGGG + Intronic
1101173961 12:102129546-102129568 TTTTTCCTCTGTTTTTTTCTAGG + Intronic
1101663208 12:106785600-106785622 GTTTAACTCTGACTTTCTTTTGG + Intronic
1101868095 12:108537960-108537982 TGTTCCCTGGGGTTTTCTTTGGG - Intronic
1102464547 12:113120766-113120788 TCTTCCATCTGATTTTTCTTTGG + Intronic
1102898620 12:116618652-116618674 TTTTCACACCGTTTTTCTTTGGG - Intergenic
1103247299 12:119469039-119469061 TTTTACCTGTGTTTTCCTTTTGG - Intronic
1103656893 12:122478078-122478100 TTTTGCCACTGTTTTCCTTTTGG + Intronic
1103770651 12:123320822-123320844 TTTTCTCTTTGTTTTTCTTGTGG + Exonic
1103979903 12:124730139-124730161 TTTTCCCCATGCTATTCTTTTGG - Intergenic
1104209515 12:126674838-126674860 TTTGGCCTGTAATTTTCTTTTGG + Intergenic
1104354308 12:128071693-128071715 TTTTCCTTGTGATTTTTTTGGGG - Intergenic
1104459493 12:128943347-128943369 TTTTCTCTCTTTTTTTTTTTTGG + Intronic
1104530643 12:129567647-129567669 CTTTCACAGTGATTTTCTTTTGG + Intronic
1105951489 13:25233097-25233119 TTGTCCCTGTCATTTTCATTTGG - Intergenic
1105995582 13:25668624-25668646 TTATCTCTCTGTTTTTCTTTTGG + Intronic
1106178196 13:27349090-27349112 TTTTGCATCTTATTTTATTTTGG - Intergenic
1108061793 13:46540642-46540664 TTTTTCCTCTTTTTTTTTTTTGG + Intergenic
1108240114 13:48455595-48455617 TCTACTTTCTGATTTTCTTTTGG - Intronic
1109258209 13:60109931-60109953 TTTTCCCCCCGTTTGTCTTTTGG - Intronic
1109435708 13:62298002-62298024 TTTTCTCTATGATTTACTTAGGG - Intergenic
1109862665 13:68221068-68221090 TTTTCCTTTTGGTTTTATTTTGG - Intergenic
1109926952 13:69155258-69155280 TTTTCTCACTTACTTTCTTTAGG + Intergenic
1110081468 13:71319257-71319279 TTTTCCTTTTGCTTATCTTTTGG + Intergenic
1110101212 13:71606676-71606698 TTTTTCCTCTCTATTTCTTTTGG + Intronic
1110176957 13:72568444-72568466 TTTTCCCACAAATTTTCTTTTGG - Intergenic
1110376730 13:74802674-74802696 TTTTCCCTCTGCTTTCCTCAAGG - Intergenic
1110505898 13:76285542-76285564 TTTTCCCTTGATTTTTCTTTGGG - Intergenic
1110548691 13:76786943-76786965 TTTTCCCTATGTTTTCTTTTAGG - Intergenic
1110566827 13:76965623-76965645 TTTTCCCTCTCATTCCCTTAGGG + Intergenic
1110916457 13:81027009-81027031 TTTTGCCACTTATTTTCTTCTGG - Intergenic
1111328109 13:86725714-86725736 GTTTGACTCTCATTTTCTTTTGG - Intergenic
1111446902 13:88358194-88358216 TTTCGACTCTGATTTTGTTTGGG - Intergenic
1112089985 13:96072871-96072893 TTTTTACACTGTTTTTCTTTGGG - Intergenic
1112114532 13:96337758-96337780 TTTTCTCTGTTTTTTTCTTTTGG + Intronic
1112178136 13:97049065-97049087 TTTTCCATATGCTTTTCATTTGG + Intergenic
1112254056 13:97812515-97812537 TTTTCTCTCTGATTTAATCTTGG - Intergenic
1112500265 13:99937725-99937747 GTTTCCCTTTGCTCTTCTTTGGG + Intergenic
1112669992 13:101624529-101624551 TTCTACCTCTGTTTTTCTTTTGG - Intronic
1112801163 13:103110995-103111017 TTTCCCCTCATATTTTTTTTTGG + Intergenic
1112981477 13:105390074-105390096 TATTTCCTCTGATTTCTTTTAGG - Intergenic
1113776442 13:112948724-112948746 CCTTCCTTCTGCTTTTCTTTGGG - Intronic
1113947746 13:114053752-114053774 TTTTCCATTTATTTTTCTTTTGG - Intronic
1114743995 14:25126912-25126934 TTTTACCTCTGTAGTTCTTTAGG + Intergenic
1114857861 14:26472690-26472712 CTTTCCCTCTTGTTTTCTTGGGG + Intronic
1115071714 14:29330987-29331009 TTTTATCACTGATTTTGTTTAGG + Intergenic
1115074134 14:29364888-29364910 TTTTTTATCTGATTTTGTTTAGG - Intergenic
1115619595 14:35128690-35128712 TTTCATCTCTGATTTTATTTGGG + Intronic
1115771725 14:36669391-36669413 TTTTCCCTCTGCTTATATTATGG + Intronic
1116021325 14:39465236-39465258 TTTTCCATCTTATTTTCATATGG + Intergenic
1116080062 14:40160843-40160865 TTTCATCTCTGATTTTATTTTGG - Intergenic
1116267099 14:42706279-42706301 TTTTCTCTCTAATTTTCCCTAGG + Intergenic
1117110642 14:52450219-52450241 TTTCATCTCTGATTTTATTTGGG - Intronic
1117453097 14:55871480-55871502 TTTTCCTTATAATTTTTTTTAGG - Intergenic
1117461524 14:55950062-55950084 TTTTCCCTGTGTTTTGTTTTAGG - Intergenic
1118015185 14:61653169-61653191 TTTTCTCTCTCATTTCCTTCAGG + Intronic
1118042719 14:61935114-61935136 TTTCCCCTCTAATTTTACTTGGG + Intergenic
1118107156 14:62672749-62672771 TTATCACTCTCTTTTTCTTTGGG + Intergenic
1118283752 14:64452402-64452424 CTTTGCTTCTGATTTCCTTTAGG + Intronic
1118406134 14:65425505-65425527 TTTTCCCCCTGGTTTTATTGAGG + Intronic
1118455190 14:65939410-65939432 TTCTCCTTCTGGTTTTATTTTGG + Intergenic
1118529899 14:66692072-66692094 GTTTTCCTTTGATTTTCTGTGGG + Intronic
1118530372 14:66698294-66698316 TTTGTCCTCTGATTTGCTTCTGG + Intronic
1118548047 14:66916776-66916798 TTTACCCTCAGACTCTCTTTGGG + Intronic
1118697520 14:68399152-68399174 TTTTCCCACTAATTTTTTTGGGG + Intronic
1118960471 14:70525377-70525399 TTTTCTTTTTGATTTTTTTTGGG + Intronic
1119171609 14:72540112-72540134 TCTTCCCTCAGCTTTTCTTTTGG + Intronic
1119361706 14:74055562-74055584 TTTTTCCTTTGAAATTCTTTAGG + Exonic
1120072189 14:80116239-80116261 TTTTCAGACTTATTTTCTTTAGG - Intergenic
1120078709 14:80189986-80190008 TTCTCCCTCTGATTTCTTTCAGG - Intergenic
1120102245 14:80458609-80458631 TTTTCACTCTGATTGGCTTGTGG + Intergenic
1120151992 14:81046603-81046625 TTTTCTCTCTCATTTCCTTCTGG - Intronic
1120330660 14:83089377-83089399 TTTTCCGTCTTAGTTTATTTGGG - Intergenic
1120510415 14:85406846-85406868 TTTACCTTCTGCTTCTCTTTTGG - Intergenic
1120605553 14:86572031-86572053 TTTTCCTTCAAATTTTGTTTTGG + Intergenic
1120697737 14:87663243-87663265 TTTCATCTCTGATTTTATTTGGG - Intergenic
1120851064 14:89171221-89171243 ATTTCCTTTTGAATTTCTTTTGG - Intronic
1121071937 14:91031581-91031603 TTTTCATTATGATTTTCTATAGG - Intronic
1121548456 14:94780194-94780216 TTCTCACTGTGCTTTTCTTTTGG + Intergenic
1121557658 14:94850564-94850586 TTTTCTCTTTGATTTTCAGTAGG + Intergenic
1121692696 14:95889349-95889371 TTTTCCTTCTGATTTTAAATTGG + Intergenic
1122192349 14:100055809-100055831 TTTTCTTTCTCTTTTTCTTTTGG + Intronic
1122239610 14:100353869-100353891 TTCTCCCCCTGTGTTTCTTTAGG - Exonic
1122334237 14:100958437-100958459 TGTCCCCTTTGATTTTCTTTAGG - Intergenic
1122513498 14:102289237-102289259 TTTTTTTTCTGATTTTATTTTGG - Intronic
1122674201 14:103397148-103397170 TATTCACTCTGATTTTCTCTTGG + Intronic
1123157052 14:106237210-106237232 TTTTCCATCTCATTTTCTAAGGG - Intergenic
1124181652 15:27481426-27481448 TTTCACAACTGATTTTCTTTTGG + Intronic
1124803415 15:32857415-32857437 TTTTGCCTCTCTTTATCTTTGGG - Intronic
1125261326 15:37828593-37828615 TTTTCACTCTTATTTTCTCATGG - Intergenic
1125440383 15:39696136-39696158 TTTTCTCTCTTATTTTCATATGG - Intronic
1125450551 15:39802321-39802343 TCTTCCCTCTCATCTACTTTTGG - Intronic
1126044336 15:44624810-44624832 TTTTCCCCCTAATTTTATTTAGG - Intronic
1126269875 15:46802236-46802258 CTTTCCCTCTGATCTTCTGCAGG + Intergenic
1126301154 15:47197618-47197640 TTTTCCCACTAATTTTGTTGTGG - Intronic
1126330973 15:47531104-47531126 TTTTCACTTAGATTTTGTTTTGG - Intronic
1126348533 15:47720400-47720422 CTTTCTCTCTTTTTTTCTTTTGG + Intronic
1126464308 15:48947188-48947210 TTTTCATGCTGATTTTCTTTTGG - Intronic
1126501412 15:49349919-49349941 TTCTCCCTCTCATTTTGTTTTGG - Intronic
1127119631 15:55759955-55759977 TTTTCTCTCTGATTGTTTTTAGG + Intergenic
1127123629 15:55791895-55791917 TTTGTCATCTGATTTCCTTTTGG - Intergenic
1127324122 15:57877993-57878015 TTTTCCCTCTAATTTTGAATTGG - Intergenic
1127331892 15:57947931-57947953 TTTTCTCTCTGCTGTCCTTTAGG + Intergenic
1127393725 15:58527111-58527133 TTTCCCCTAAGATATTCTTTTGG - Intronic
1127648320 15:60980411-60980433 TGTTCCCTCTGCTATTTTTTTGG + Intronic
1127802887 15:62493048-62493070 TGTTCCCTCTGGCCTTCTTTGGG + Intronic
1127910532 15:63412726-63412748 TTTTCCATCTGTTCTTCCTTTGG + Intergenic
1128194629 15:65740965-65740987 TTTTACATTTGATTTTTTTTGGG - Intronic
1128444760 15:67749019-67749041 TTATCACTCTGATATGCTTTGGG - Intronic
1128583266 15:68824207-68824229 TTTTCCATGTCATTGTCTTTGGG - Intronic
1129131739 15:73504562-73504584 TTTCTCCTCTGGGTTTCTTTAGG + Intronic
1130138469 15:81201598-81201620 TTTTCCCTCTTTTTCTTTTTAGG + Intronic
1130292082 15:82611793-82611815 TTTTTCCTATTGTTTTCTTTGGG - Intronic
1130420527 15:83742428-83742450 TTTTTCTTCTGAATTCCTTTAGG - Intronic
1130569450 15:85027802-85027824 ATTTACCACTGATTTTTTTTTGG + Intronic
1130737719 15:86567980-86568002 TCTTGCTTCTGATCTTCTTTGGG + Intronic
1130757683 15:86783406-86783428 TTTACCCTTTCTTTTTCTTTGGG + Intronic
1131147840 15:90026063-90026085 TTTCCCCTCTCATTTTCCTTAGG - Intronic
1131330288 15:91491634-91491656 TTGTCTCTCTGATTGGCTTTGGG - Intergenic
1131501497 15:92971886-92971908 TTTTCCCTTTCATTTTCTTCAGG - Exonic
1131610488 15:93956028-93956050 TTTTTCTTCTGGATTTCTTTAGG + Intergenic
1131662584 15:94534416-94534438 ATTTTCCACTGATTTTCTTCTGG - Intergenic
1131892767 15:96991720-96991742 TTTTATCTCTAACTTTCTTTTGG + Intergenic
1131921615 15:97334319-97334341 TTTTCTCTTTGATTCTCATTTGG - Intergenic
1132015360 15:98311308-98311330 TTTTCCCTAAAATTTTCTTTTGG - Intergenic
1132072498 15:98790686-98790708 TTTTCCTTCCGATTTCCTTAAGG - Intronic
1133612323 16:7445018-7445040 TTTTTCTTCTTTTTTTCTTTTGG + Intronic
1134265071 16:12685677-12685699 TTTTCCTCCTGATTTTGTTCTGG + Intronic
1134914344 16:18057316-18057338 TTTTCTCCTCGATTTTCTTTTGG - Intergenic
1135166033 16:20139966-20139988 TGTTCCCTCAGATTTCCTTATGG + Intergenic
1135233566 16:20732927-20732949 TTCTCCCAATGATTGTCTTTGGG - Intronic
1135246374 16:20860752-20860774 TTTCCCTTCTGATTCTCTATGGG + Intronic
1135493766 16:22933393-22933415 TTTCCTCTCTGAGTTTATTTTGG - Intergenic
1135878979 16:26234455-26234477 TTTTCCTTCTCATTTATTTTAGG + Intergenic
1136345639 16:29673996-29674018 TTTTCTCTCTACTTTTGTTTGGG - Intronic
1137779252 16:51083776-51083798 TTTTCCCTTTGCTTTTTTGTGGG - Intergenic
1138095409 16:54207312-54207334 TTTTTCCTCTGCCTTTCTCTTGG + Intergenic
1138568568 16:57852105-57852127 TTTTCCTGCTTATTTTATTTTGG + Intronic
1139080839 16:63518816-63518838 TTTTTCCCCTCATTGTCTTTTGG + Intergenic
1139396546 16:66644445-66644467 TTTTCTTTCTGTTTTTGTTTTGG - Intronic
1140629870 16:76838288-76838310 TTTTGCCTCTGATTCTTTTAAGG + Intergenic
1140910975 16:79452558-79452580 TTTACCCTCTCATTTTCTCAGGG + Intergenic
1140950352 16:79810884-79810906 TTTTTCCTTTCCTTTTCTTTAGG + Intergenic
1141335592 16:83152073-83152095 TTTTTCCTCTAATTTTCCTTAGG - Intronic
1143956664 17:10675447-10675469 TTTCCCCTCTACTTTTCTTTTGG + Exonic
1144066564 17:11629667-11629689 TTTTCCCTGTGTATTTCCTTTGG + Intronic
1144217768 17:13071720-13071742 TTCACCCTCTGATTTCCTGTGGG + Intergenic
1144251707 17:13423095-13423117 TGTTCCCTCTGAGCTTGTTTGGG - Intergenic
1144631648 17:16876067-16876089 ATGTCCCGCTGATTTTTTTTTGG + Intergenic
1145846504 17:28042661-28042683 TTTTCCCTTTTTTTTCCTTTTGG + Exonic
1145850897 17:28095058-28095080 TTTTCCTTCTAATTTTATTCTGG - Intronic
1148041998 17:44715175-44715197 TTCTTCCTTTGATTTTCTTGTGG + Intronic
1149149323 17:53541104-53541126 CTTTCCCTTGCATTTTCTTTTGG + Intergenic
1149231454 17:54538776-54538798 TTTTCATTCTGATTTTATTTGGG + Intergenic
1149511948 17:57249570-57249592 GTATCCCTCTCATTGTCTTTTGG - Intergenic
1149854134 17:60064598-60064620 TTTTCTCTAGGATTTTCTTGTGG + Intronic
1149936520 17:60812216-60812238 TTTTCTCTCTTAAATTCTTTGGG + Intronic
1149970040 17:61208701-61208723 TTTTCCTTCTAATTCTGTTTGGG - Intronic
1150307861 17:64101409-64101431 TTTTCCCTTTCTTTTTTTTTTGG - Intronic
1150460687 17:65347854-65347876 TTTTATCTCTGTTTCTCTTTAGG + Intergenic
1150581730 17:66480410-66480432 ATTTCCCTCTGCTTATCTTGGGG - Intronic
1151040146 17:70850067-70850089 TTTTCCCTTTCCTTTTCTTTTGG - Intergenic
1153213874 18:2798743-2798765 TATTCCCTCTGCTTTTATATAGG + Intronic
1153457130 18:5294945-5294967 TCCTCCCTCTCAATTTCTTTGGG + Intronic
1155011363 18:21781867-21781889 TTTTGTTTCTGATTTTATTTGGG + Intronic
1155418345 18:25626434-25626456 TTTTCTCTCTGTTCTTCTTCTGG + Intergenic
1155460368 18:26073407-26073429 TTCTCCCTTTTACTTTCTTTTGG - Intronic
1155751415 18:29427144-29427166 TGTTCCCACTGGTTTTATTTGGG - Intergenic
1156012825 18:32513651-32513673 ATTATCCTCTGACTTTCTTTGGG - Intergenic
1156269649 18:35519093-35519115 TTTTCTTTTTGAATTTCTTTTGG - Intergenic
1156535316 18:37858381-37858403 TTTTCCCTCTGTTTTGATGTAGG + Intergenic
1156598615 18:38577197-38577219 TCTTCCCTCTGAATGTATTTTGG + Intergenic
1156604460 18:38649905-38649927 TTCTTTCTCTGGTTTTCTTTTGG + Intergenic
1156793947 18:41017308-41017330 TTTCCTTTCTGATTTTATTTGGG - Intergenic
1156830286 18:41483638-41483660 TTTTACTTCATATTTTCTTTTGG + Intergenic
1157275726 18:46310094-46310116 TTTCCCGTATGATTTTCTCTGGG - Intergenic
1158171056 18:54600326-54600348 TTTTCCCACTGAATTGCCTTTGG - Intergenic
1158386075 18:56993366-56993388 TTTTTTCTTTTATTTTCTTTTGG + Intronic
1158680914 18:59565844-59565866 TTTTGCATTCGATTTTCTTTGGG - Intronic
1158816081 18:61098758-61098780 CTTTCTCTCTTTTTTTCTTTAGG - Intergenic
1158830969 18:61278119-61278141 TCTTCCCTCTTCTTCTCTTTGGG - Intergenic
1159184908 18:64957106-64957128 TTTGCCATCTAATGTTCTTTAGG + Intergenic
1159337406 18:67087826-67087848 TTTTCCCTCTGGTGGTTTTTAGG - Intergenic
1159756550 18:72372426-72372448 TTGCCCTTCTGATTTTATTTTGG + Intergenic
1159838354 18:73368577-73368599 TTTTCCATCTGACTTACTTCTGG - Intergenic
1163656309 19:18547379-18547401 TTTTCCCTTTTTTTTTTTTTTGG + Intergenic
1163910039 19:20181232-20181254 TTTTCCCTTTCATCTGCTTTTGG - Intronic
1164329451 19:24239315-24239337 TTTTCCTTCTGATTTTTATCTGG + Intergenic
1164640520 19:29821974-29821996 TTTTCTCTCTGTTTTCCTTTAGG + Exonic
1164665802 19:30035559-30035581 TTTTCCCTCTGGTTTCTTTCAGG + Intergenic
1164884561 19:31767559-31767581 TTTGCGCTGTGCTTTTCTTTTGG - Intergenic
1165139766 19:33691745-33691767 TTCTCCCTGTGAATTTCTGTTGG + Intronic
1165192518 19:34077120-34077142 TTTTCCTTCTTCTCTTCTTTTGG - Intergenic
1165241162 19:34468746-34468768 TGTACCCTCTGCTTTTCTATTGG + Intronic
1165296817 19:34933936-34933958 GTTTCCCTCTCATTTTATTACGG + Intronic
1165340238 19:35206124-35206146 TTACCCTTCTCATTTTCTTTGGG + Intergenic
1165582619 19:36880996-36881018 TTTTCCCTCCCATTATCCTTAGG - Intronic
1165663829 19:37608573-37608595 TTTTCCTTCTAATTTTTTGTTGG + Intronic
1166216324 19:41337846-41337868 TCTTCCTTATGATTTTCTTAAGG + Intronic
926613694 2:14973507-14973529 TTCTCTCTCTGTTTTTCTGTTGG - Intergenic
927461335 2:23300954-23300976 TGTTCACTCTGATAGTCTTTGGG - Intergenic
927628553 2:24750138-24750160 TTTTTTCTCTGATTTCATTTTGG - Intronic
927664612 2:25021946-25021968 ATATCACTCTGACTTTCTTTGGG + Intergenic
928148181 2:28801690-28801712 TCTTTCCTCTGATTTTTTTCAGG + Exonic
928150855 2:28827251-28827273 TTTTCTATCTGTGTTTCTTTGGG + Intronic
928188163 2:29134325-29134347 TTTTCTCTCTGGTTCTCTTGGGG + Intronic
928258648 2:29747185-29747207 TTTTCCCTCTAGTTTTCCATAGG - Intronic
928371585 2:30743902-30743924 TTTTGACACTGATTTTCTTCTGG + Intronic
928415474 2:31088121-31088143 TTTTTTCTCTGAGTTTGTTTGGG - Intronic
928474581 2:31613904-31613926 TTTTCCCTATACTTTTCTTGTGG - Intergenic
929522910 2:42671476-42671498 ATTTTCTTCTGCTTTTCTTTAGG + Intronic
929782485 2:44966020-44966042 TTTCCCCTCAGACTGTCTTTTGG + Intergenic
929960776 2:46494730-46494752 ATTTCCCCTTGATTTTCTTTTGG + Intronic
930277206 2:49325811-49325833 TTTTCCCCTTCATTTTCTTTTGG + Intergenic
930291388 2:49497831-49497853 CTTTCCCACTGCTTTTCCTTAGG - Intergenic
930417048 2:51102640-51102662 TTTTAGCTCTGATTTCCTTTAGG + Intergenic
930445221 2:51462376-51462398 TATGCTCTCTGATTATCTTTGGG + Intergenic
930454980 2:51596327-51596349 TTTTCCTTCATTTTTTCTTTTGG - Intergenic
930760789 2:55033217-55033239 TTTTTCCTCTGACTGTTTTTAGG - Intronic
931085964 2:58830961-58830983 TTTGCCCTGTTATTTTCTTGAGG + Intergenic
931144730 2:59505198-59505220 TTTTCCCTCTTATTATGGTTTGG + Intergenic
931156780 2:59641697-59641719 TTCTTCCTCCTATTTTCTTTGGG + Intergenic
931327001 2:61236965-61236987 TTATACTTCTGATTTTATTTTGG + Intronic
931427005 2:62180346-62180368 CTTCCCCTCTTGTTTTCTTTTGG - Intergenic
931704133 2:64932955-64932977 TTTTACATCTTAATTTCTTTGGG - Intergenic
932332946 2:70909093-70909115 TTTATCCTTTGATTTTGTTTAGG + Intronic
932473632 2:71983742-71983764 TATTCCCTCTTTTTTTCTATTGG + Intergenic
933172692 2:79141210-79141232 TTTACCTTCAGGTTTTCTTTGGG + Intergenic
933537391 2:83593046-83593068 TTTTTCCTCTACTTTTTTTTTGG - Intergenic
933852540 2:86382101-86382123 TTTTCTCTCTTATCTCCTTTGGG + Intergenic
934914865 2:98292963-98292985 TTTTCTCTCTCTTTTTTTTTTGG - Intronic
935137159 2:100317231-100317253 TCTTCCCTCCCATTTTCTTTTGG + Intronic
935187769 2:100749539-100749561 TTTTCTCTCTGTTATTCATTGGG - Intergenic
935417499 2:102834367-102834389 TTTTCCTTCTGATCTTCTCTTGG + Intronic
935502352 2:103856961-103856983 TTCTCTCTCTTATTTCCTTTAGG - Intergenic
935581967 2:104763710-104763732 TTTTCCCTCTGTCTTAGTTTCGG - Intergenic
935667857 2:105528084-105528106 TTTTCCCTCTCTTTTCCTTTTGG - Intergenic
936052767 2:109237764-109237786 TTTTCAGGATGATTTTCTTTTGG - Intronic
936235457 2:110738832-110738854 TTTTCCATCTCTTTGTCTTTTGG + Intronic
936370776 2:111899982-111900004 TTTCCCCTTTCTTTTTCTTTTGG - Intronic
936805016 2:116320779-116320801 TTTTCTCTCTTATTTGCTTCTGG - Intergenic
937018221 2:118626161-118626183 TTTTGCCTCATATTTTCTTCTGG + Intergenic
937512504 2:122611862-122611884 TTTTCCCTCTGCTTTTCTTAAGG - Intergenic
937940421 2:127280977-127280999 TTCTCCTTTTCATTTTCTTTTGG - Intronic
938646485 2:133336139-133336161 TCTTTCCTCTGCTTTTCTGTTGG - Intronic
939024725 2:136998340-136998362 TTTTCCCTTTGTTTTTCACTGGG + Intronic
939201920 2:139046335-139046357 TTTTCTCTCATATTGTCTTTAGG - Intergenic
939398886 2:141666271-141666293 TTCTCACACTGATTTTCTTCAGG - Intronic
939516702 2:143177699-143177721 TTTTCACTCTGATTTTTATAAGG + Intronic
939583206 2:143976197-143976219 TTTTTCCTCTGATTATATGTGGG - Intronic
939867524 2:147489804-147489826 TTTTCCTTAAAATTTTCTTTGGG + Intergenic
939990602 2:148874935-148874957 TTTCCCAAGTGATTTTCTTTTGG + Intergenic
940442243 2:153730486-153730508 TTATCCCTGTGATTTCCTATAGG - Intergenic
940497742 2:154454875-154454897 TTTTCCTTCTAATTATCTTCAGG + Intergenic
940515629 2:154680926-154680948 TTTCCTTTCTCATTTTCTTTTGG + Intergenic
940716415 2:157230175-157230197 TTTTGTTTCTGATTTTATTTAGG + Intergenic
940821732 2:158363386-158363408 TTTTCACACTGATTTTCATCAGG - Intronic
940930857 2:159428925-159428947 TTTGCCATCTGATTTGCTCTTGG + Intronic
940932427 2:159449384-159449406 TTTTTCCTCTAATGTTCTTATGG - Intronic
940933904 2:159469091-159469113 ATTTCCTTCTGTTTTTCTATGGG - Intronic
941007154 2:160259626-160259648 TTTGCCTTCTGACTTTCTCTGGG - Intronic
941885812 2:170525977-170525999 TTTTCCCTCTGGTTTCATGTGGG - Intronic
942364586 2:175210945-175210967 TCTTCCCTCTGTTTTTTTTCAGG + Intergenic
942369253 2:175264484-175264506 TTTTCCCCCTCTTTCTCTTTGGG + Intergenic
942919913 2:181359957-181359979 TTTTCCATCTGATTTCCTGGGGG + Intergenic
943429884 2:187785946-187785968 TTTCATCTCTGATTTTATTTGGG - Intergenic
943776182 2:191768720-191768742 TTTTCCATCAGATTTTCTTATGG + Intergenic
943829651 2:192444028-192444050 TCTTCCCTGAGTTTTTCTTTTGG - Intergenic
943884022 2:193188702-193188724 TTTTACCTCTGTGTTTCATTTGG + Intergenic
943967326 2:194353869-194353891 TTTTCTCTCTGCTTTTCTCAAGG - Intergenic
944086827 2:195858058-195858080 TTTTGCCAGTGATTTTTTTTGGG - Intronic
944241603 2:197491059-197491081 TTATTCCTCTGATTTTTATTTGG - Intronic
944706150 2:202290897-202290919 TTTTTACTCTGATTATTTTTTGG + Intronic
945017343 2:205533226-205533248 TTTTCCTTCTGCCTTCCTTTGGG - Intronic
945260979 2:207843263-207843285 TTTTCCTTTTCATTGTCTTTGGG + Intronic
945491476 2:210460931-210460953 TTTTTCATCTTATTTTCTATTGG - Intronic
945634663 2:212332825-212332847 ATAACCCTCAGATTTTCTTTTGG - Intronic
945685704 2:212966855-212966877 TTTGCCCTCTGGTTTATTTTTGG + Intergenic
945698758 2:213143473-213143495 TTTTCCCTTTTTTTCTCTTTTGG + Intronic
945874656 2:215265828-215265850 TTTTCTCTCTGATTTTTTTAAGG + Intergenic
945957136 2:216096896-216096918 TTTGCCATATGATTTTCTTCTGG - Intronic
946491123 2:220150140-220150162 TTTGCCCTCTGACTTACTCTTGG + Intergenic
946611952 2:221468216-221468238 TTTTTCCTCTGATCTTCCCTAGG - Intronic
946733352 2:222730235-222730257 GTTTCACCCTGATTTTCCTTTGG - Intergenic
946959185 2:224965522-224965544 TTTTCTTTCTGCTTTTCTTGTGG + Intronic
947415565 2:229891624-229891646 TTTTCCTTTTTAATTTCTTTTGG - Intronic
947562069 2:231163704-231163726 TTTTCCTTTTCTTTTTCTTTTGG - Exonic
948403049 2:237698241-237698263 CTTCCCCTCTGAAATTCTTTGGG - Intronic
948622087 2:239242044-239242066 TTTTCTCTTTTCTTTTCTTTTGG - Intronic
1168984678 20:2038031-2038053 GCTTCCCTCTGATGTTCTCTGGG + Intergenic
1170004965 20:11657428-11657450 TTTTCCCTTTTTTTTTTTTTCGG - Intergenic
1170332572 20:15230318-15230340 TTTTGCCACTTACTTTCTTTTGG + Intronic
1170423393 20:16214445-16214467 TCTTTTGTCTGATTTTCTTTAGG - Intergenic
1170808846 20:19657843-19657865 TTTTTCTTCTGATTTCCCTTAGG + Intronic
1171029921 20:21668372-21668394 TTTTCCCTTTGTTATTATTTTGG + Intergenic
1171143949 20:22765754-22765776 CTTTTCCTCTGACTTTCTTGGGG + Intergenic
1171187919 20:23136762-23136784 TTCTCCCGCTGTTTTTCTTGGGG + Intergenic
1172337517 20:34129592-34129614 TTTTCTATCTGATATTCTCTTGG - Intergenic
1172495412 20:35379252-35379274 TTTTCTCTATCTTTTTCTTTAGG - Intronic
1172791445 20:37508599-37508621 TTTTCCCTCTGGTTTTTAATGGG + Intronic
1172850704 20:37961408-37961430 TTTTCTCTCTGTGTTGCTTTGGG + Intergenic
1173039620 20:39450053-39450075 TTTTCTCTCTGACTTTCAGTAGG - Intergenic
1173177432 20:40774875-40774897 TTTACACTCTGATTTTAGTTGGG - Intergenic
1173232848 20:41214860-41214882 CTTTCCTTCTGAATCTCTTTTGG - Intronic
1173386277 20:42591250-42591272 CTTTCCCTCTCTTTTTCTTTTGG - Intronic
1174094975 20:48081237-48081259 TTTATTGTCTGATTTTCTTTTGG + Intergenic
1174129930 20:48336573-48336595 TTTTCCCTGTGATGTTATTTTGG - Intergenic
1174695883 20:52557843-52557865 TTTTGCTTTTGATTTTATTTTGG + Intergenic
1174908663 20:54580971-54580993 TTTTCCCTCTGTTTTATTCTAGG + Intronic
1175430204 20:58896309-58896331 TGTTCCCTCTTCTTTTCTGTAGG - Intronic
1175660812 20:60810421-60810443 TTTTCTCTCTTAGTTTCTGTGGG + Intergenic
1177032273 21:15996264-15996286 TCTTCTCTCTGATGTTCCTTGGG - Intergenic
1177240940 21:18455856-18455878 TTTTCACTCCTATTTCCTTTTGG - Intronic
1177343667 21:19839142-19839164 TTTTCTCTCTCTTTTCCTTTTGG - Intergenic
1177402657 21:20625308-20625330 TTATACTTCTGATATTCTTTGGG - Intergenic
1177421898 21:20870216-20870238 TTTTCCCCGTGATGTTCTCTTGG + Intergenic
1177902633 21:26935082-26935104 TTCACCATCTGATTTTCTCTAGG - Intronic
1178002176 21:28174597-28174619 TTCTCCCTCTGAGTGTCGTTTGG + Intergenic
1178583123 21:33852539-33852561 TTTTCCCCGTGATTTTCTCCAGG + Intronic
1178770584 21:35500064-35500086 TTTTCCCTCCGTTTTTATATTGG - Intronic
1179026239 21:37681218-37681240 TTTTCTCTCTAATTCTCTTCAGG + Intronic
1179039358 21:37788333-37788355 TGTTCCCTCTAATTTTCTTTGGG + Intronic
1179389417 21:40973970-40973992 TTTTCCCTTTGAATTTCTGTTGG - Intergenic
1181721684 22:24780234-24780256 TCTTCCCTCTGGTATTCTTGGGG + Intergenic
1181749398 22:24978224-24978246 TTTTCCCCATGCTGTTCTTTTGG + Intronic
1181779815 22:25184544-25184566 TTTGCCCTCCGGTTTTCTTATGG + Intronic
1183021739 22:35032955-35032977 TTTTTTCTCTGATTTGTTTTTGG - Intergenic
1183969347 22:41464950-41464972 ATTTGCCTCTCCTTTTCTTTAGG - Intronic
1184064499 22:42109746-42109768 TTTTCCTTCTGAGTTTTCTTTGG + Intergenic
1184372878 22:44093770-44093792 TTTTCCCTCTGACTCTTTCTGGG + Intronic
1184444031 22:44536702-44536724 CTTTCCACCTGATGTTCTTTGGG - Intergenic
1184904797 22:47474156-47474178 TTTCTCCTCTGATTTCTTTTAGG - Intronic
1185300257 22:50075993-50076015 TTTTCCCTCTAATTTTGGATGGG - Intronic
949663849 3:6313907-6313929 TTTTCCCTCTTATTCTATTGTGG + Intergenic
949794903 3:7838715-7838737 TTTTCCTTCTGTTTTGTTTTTGG - Intergenic
950076798 3:10193141-10193163 TTTTCTCTCTGATTTGTTTTCGG - Intronic
950186472 3:10948589-10948611 TTGGCCCCCTGATTTCCTTTTGG - Intergenic
950732504 3:14973225-14973247 TTTCCTCTATGATTTTTTTTTGG + Intronic
951143134 3:19192136-19192158 TTTTCCCTCTTATTATTGTTTGG + Intronic
951536486 3:23744994-23745016 TTTTCCCATTCATTTTCTCTCGG - Intergenic
951697090 3:25456324-25456346 ATTTCCCACTGACTTTCTTGGGG + Intronic
951743886 3:25954965-25954987 ATTTCACTCTGATTTTCTCTTGG - Intergenic
953003900 3:38959768-38959790 TTTGCTTTCTGATTTTCTTATGG - Intergenic
953119141 3:40022741-40022763 TTTTCCCTCTCTTTTACTTCAGG - Intronic
953617978 3:44509120-44509142 TTTTTCTTTTGCTTTTCTTTTGG - Intronic
953889285 3:46739008-46739030 TTTTCCTTCAGATTTTCCTCTGG - Intronic
953889408 3:46740833-46740855 TTTTCCTTCAGATTTTCCTCTGG - Intronic
954564731 3:51589989-51590011 TTTTTTCTTTGTTTTTCTTTTGG + Intronic
954609864 3:51938676-51938698 TTTTCTCCCTCTTTTTCTTTAGG + Intronic
954656393 3:52196889-52196911 TTTTCTCTCTCATCTTCTCTGGG + Intergenic
954770870 3:52967065-52967087 TTTTCCCTCTGCTTTCCTGTGGG - Intronic
955347406 3:58171350-58171372 TCTGCCCTCTGAGTTTCTGTAGG - Intronic
955678562 3:61475706-61475728 TCTTCTCTCTGGTTTTCTCTAGG + Intergenic
955930091 3:64047763-64047785 TTTCCTCTCTCTTTTTCTTTAGG - Intergenic
956466787 3:69527469-69527491 CTTTGCCTCTGCTTTGCTTTTGG - Intronic
956480021 3:69664016-69664038 TTTCCCCTCCTATTTTCTTCTGG + Intergenic
956708370 3:72018931-72018953 TTTCCCATCTTATTTTCTATGGG + Intergenic
956871160 3:73419559-73419581 GTTTCCCCCTGCTTTTGTTTGGG + Intronic
957194771 3:77053516-77053538 TTTTATCTCTGATTGCCTTTGGG - Intronic
957641887 3:82863978-82864000 TTTTCCCTCTGTTTTCTTCTAGG - Intergenic
958178203 3:90023569-90023591 TTTACCCTCTGATTTTCTGCTGG - Intergenic
958913268 3:100019184-100019206 CTTTGACACTGATTTTCTTTTGG - Intronic
959191412 3:103116626-103116648 TTTTATCTCTAATTTTATTTTGG - Intergenic
959282297 3:104360151-104360173 TTTTACCTCTGCTTTCATTTTGG - Intergenic
959435947 3:106315276-106315298 CTTTATCTCTGATTTTATTTGGG + Intergenic
960070121 3:113420168-113420190 CTTTCCCTCAGACATTCTTTTGG - Exonic
960097136 3:113699337-113699359 CTTGCCCTCTGATTCTCTTTCGG + Intergenic
960564916 3:119122950-119122972 TTTTCCCTCTGCTTTTCTCAAGG - Intronic
961586715 3:127934487-127934509 TTCTCTCTCTCATTTCCTTTTGG - Intronic
962193886 3:133340224-133340246 TTTCATCTCTGATTTTATTTGGG - Intronic
962734312 3:138311030-138311052 TTTTCTTTCTGATTTTATTTGGG - Intronic
963242919 3:143027815-143027837 TTTTCCATCAGATTTTGATTTGG + Intronic
963664768 3:148168932-148168954 TTTTCACTCAGTTTCTCTTTAGG - Intergenic
964070981 3:152633095-152633117 TCATCCCTCTGATTTGTTTTCGG + Intergenic
964204621 3:154158784-154158806 TATTTCCTTTGATTTTTTTTTGG + Intronic
964408677 3:156376517-156376539 TTTTCCCTGTGGTTGACTTTTGG - Intronic
964581078 3:158238763-158238785 TATTCCCTCTGTTTTTTTCTAGG - Intronic
964582433 3:158255159-158255181 TATTCCCTCTGTTTTTTTCTAGG + Intronic
964725995 3:159814995-159815017 TTTTCCTTCTGAGTTCCTTAAGG + Intronic
964870120 3:161304421-161304443 TTTTCCCTATGTTTTCTTTTAGG - Intergenic
964875673 3:161365938-161365960 TTTTCCCTCTTTTTTTCAGTTGG + Intronic
964928064 3:161981385-161981407 TTTTCTCACTGATTTTATTTGGG + Intergenic
965073379 3:163944282-163944304 ATTTCCCTCTTAATTTCCTTAGG - Intergenic
965206618 3:165726613-165726635 TTTTCCCTAAAATTTTATTTTGG + Intergenic
965239599 3:166177877-166177899 CTTTCACTCTGATTTTTATTGGG - Intergenic
965323115 3:167271487-167271509 TTTTCCTTCTGAGTTTTCTTTGG - Intronic
965496178 3:169401694-169401716 TTTTCCCTCATCTTTTCTCTGGG - Intronic
965562528 3:170075247-170075269 TTTTCCTTCTGATATTCTTTTGG - Intronic
965808880 3:172572325-172572347 TTTTCCCTCCTATCTTCTATGGG - Intergenic
965868143 3:173231463-173231485 ATTTCCCTCAGCTTTTCTTAAGG + Intergenic
966052121 3:175632075-175632097 TTTTTCCTCTGATATGGTTTGGG + Intronic
966159913 3:176957108-176957130 TTTTCCATCTGATTAAGTTTAGG + Intergenic
967083016 3:186067848-186067870 TTTTTCCTCAGTTTTACTTTTGG - Intronic
967147895 3:186621394-186621416 TTTTCACTTTGATTTTGATTAGG - Intergenic
967525210 3:190484836-190484858 TTATCACTATGATTTACTTTGGG + Intergenic
967671657 3:192243184-192243206 AGTTCTCTCAGATTTTCTTTTGG - Intronic
967696648 3:192540002-192540024 TTTCACCTCTGATTTTTTTGGGG + Intronic
968685566 4:1956057-1956079 AATTCCCTGTGTTTTTCTTTGGG + Exonic
969304207 4:6316384-6316406 TTTTCTCACCTATTTTCTTTGGG + Intergenic
969981536 4:11161640-11161662 TCTTGCCTCTGATTTTCTCTGGG + Intergenic
970287362 4:14532759-14532781 TTTTCCCTCCAATTTTGTCTAGG - Intergenic
970627310 4:17901760-17901782 TTTTCCTCCTTATTTTCTTTTGG - Intronic
970660994 4:18285663-18285685 TTGTCTCTCTGGTTGTCTTTGGG + Intergenic
970667154 4:18350468-18350490 TCTTCACTTTGATTTTTTTTTGG + Intergenic
970851768 4:20612310-20612332 TTTTTCCTCTTTTTTTTTTTTGG - Intronic
970953360 4:21782006-21782028 TTTTTTCTCTGCCTTTCTTTGGG - Intronic
971038496 4:22722767-22722789 TTTTCTCTCTCATTATATTTGGG + Intergenic
971166868 4:24192468-24192490 TATTCCTTTTGGTTTTCTTTGGG + Intergenic
971557490 4:28032890-28032912 TTTCATCTCTGATTTTATTTGGG - Intergenic
971567541 4:28164626-28164648 TTTCATCTCTGATTTTATTTGGG + Intergenic
971978409 4:33721303-33721325 TTCTCCCTCTGCTATTCCTTGGG - Intergenic
972035898 4:34520380-34520402 CTTTCTCACTGATTTTATTTAGG - Intergenic
972088622 4:35252638-35252660 TTTTCCTTCTGATTTTCTGGTGG - Intergenic
972890584 4:43552110-43552132 TTTTATCTCTGATTTTATTTGGG + Intergenic
973252640 4:48076520-48076542 TTTTTCCTCTCCTTTTCCTTAGG + Intronic
973574020 4:52267800-52267822 TTTCCTCCCTGATTCTCTTTGGG + Intergenic
974093103 4:57333185-57333207 TTTTCCTACTGATGTGCTTTGGG + Intergenic
974099655 4:57402706-57402728 TTGTCCCTCTGTATTTCTGTGGG + Intergenic
974161329 4:58144598-58144620 TTTTGATTCTGATTTTTTTTTGG + Intergenic
974352591 4:60769150-60769172 TTTTATCTCTGATTTTATTTGGG + Intergenic
974589868 4:63932255-63932277 TTTTATTTCTGATTTTATTTGGG - Intergenic
974632371 4:64510178-64510200 TTTTCCCTCTATTTTTGTTTGGG + Intergenic
975168901 4:71210606-71210628 ATTTCCCTAAGATTTTCCTTGGG - Intronic
975264804 4:72350788-72350810 TGTTACCTCTGATTTTTTTTAGG + Intronic
975303698 4:72822775-72822797 TTTTCTTTCTGCTTTTCTTGTGG - Intergenic
975671984 4:76789327-76789349 TTTTGCTTCTGATTTTATTTGGG - Intergenic
976022745 4:80649703-80649725 TTTTGCCTTTCATTTTATTTAGG - Intronic
976091991 4:81468625-81468647 TTTTTGCTTTGTTTTTCTTTAGG - Intronic
976178705 4:82379407-82379429 TTTTCTCTCTTACTTTCTTCAGG - Intergenic
976369465 4:84270270-84270292 TTTTCTCTCTCTTTATCTTTTGG - Intergenic
976841180 4:89433829-89433851 TCTTCCCTCTGATCTTCCTCTGG - Intergenic
976916860 4:90386782-90386804 TTTTCCTTCTGATTTTCATATGG + Intronic
976994716 4:91416184-91416206 TGTTCTCTCTGATTTCCTTGAGG - Intronic
977343610 4:95791373-95791395 TTTTCACTCATAATTTCTTTGGG - Intergenic
977382504 4:96294135-96294157 TTCGCCCTGTGATTTTCTTTGGG - Intergenic
978789806 4:112649612-112649634 TTCTGACTCTGATTTTATTTGGG - Exonic
978797974 4:112727626-112727648 CTTTCATTCTGATTTTATTTGGG - Intergenic
978817028 4:112918354-112918376 CTTTCCCACTTATGTTCTTTCGG - Intronic
979569677 4:122205224-122205246 TTTTACCTGTAATTTTCCTTAGG + Intronic
980304403 4:131038845-131038867 TTTTCCCTCTCATTTTAACTCGG - Intergenic
980717851 4:136651568-136651590 TTTTCCCACTAATTTTAATTAGG + Intergenic
981183535 4:141774084-141774106 GTTTCATTTTGATTTTCTTTTGG - Intergenic
981248410 4:142568091-142568113 CTTTCCCTCTGATTCTAGTTTGG + Intronic
981251234 4:142603648-142603670 GTTTCTTTCTGATTTTATTTTGG - Intronic
981545014 4:145884636-145884658 TTTTTCCTGTCATTCTCTTTTGG - Intronic
981746736 4:148059585-148059607 TTTTCCCAAAGATGTTCTTTGGG + Intronic
981905069 4:149913266-149913288 TTTTCCTTCTTTTTTTTTTTTGG + Intergenic
982027224 4:151262927-151262949 TTCTGCCTCTGATTTTCCTGAGG + Intronic
982099816 4:151957056-151957078 TTTTCTCTCTCTTTTTCTGTTGG + Intergenic
982313903 4:154011786-154011808 TTTGTCCTCTCTTTTTCTTTTGG + Intergenic
982519734 4:156399393-156399415 TATTCCCTGTGATTTTCTTTAGG - Intergenic
982527762 4:156501390-156501412 TTTGTCCTCTGATTTTAGTTAGG + Intergenic
982724055 4:158886774-158886796 GTTTCTCTCAGATTTTCATTTGG + Intronic
983165656 4:164473996-164474018 TTTCATCTCTGATTTTATTTGGG + Intergenic
983311746 4:166073182-166073204 TTTTCACTCTGACTTTCTAGAGG - Intronic
983403909 4:167301317-167301339 TTTCCCTTATGATTTTCTCTTGG - Intergenic
983442549 4:167805140-167805162 CTTTCCCTATGCTTTTTTTTAGG + Intergenic
983729273 4:170972953-170972975 TTTTCCTTATGGTTTTGTTTAGG + Intergenic
983853062 4:172607121-172607143 TTTTTTCTCTTATTTTTTTTGGG - Intronic
983875714 4:172872280-172872302 TTTTTCCTCAGATTATTTTTAGG + Intronic
984354656 4:178642239-178642261 TTTTTCCTTTTATTTTATTTTGG - Intergenic
984457717 4:179992034-179992056 TTATCCCTCTGTTTTGCATTCGG - Intergenic
984630840 4:182059346-182059368 TTTTGACACTGATTTCCTTTAGG - Intergenic
985028294 4:185761685-185761707 CTTTTCCTCAGATTCTCTTTCGG - Intronic
985363539 4:189201558-189201580 TTCTCCCTCTTAGTTTCTCTCGG - Intergenic
985623370 5:968300-968322 GTTTCCCTGTGATTTTCAATAGG + Intergenic
985654985 5:1126463-1126485 TTTTTCTTCTGATTTGTTTTTGG + Intergenic
986548339 5:8924372-8924394 TCTTCTCTCTGATTTTCTCAAGG - Intergenic
987004337 5:13694186-13694208 TTTTCCCTCCATTTTTCTGTTGG - Intronic
987034964 5:14010319-14010341 CTTTGCCTCTAATTTTCTCTTGG - Intergenic
987130955 5:14859816-14859838 ATTTTACTCTGATTTCCTTTAGG - Intronic
987223786 5:15819020-15819042 GCTTCCCTATGATTGTCTTTTGG - Intronic
987327728 5:16827753-16827775 TTGGCCCTCTTATTTTGTTTTGG - Intronic
987402208 5:17490055-17490077 TTTTCTGTCGGATTTTCTGTTGG - Intergenic
987848036 5:23313576-23313598 ATTTGACTCTGATATTCTTTCGG - Intergenic
988123474 5:26998214-26998236 CTTTTCCTCTGATTTTCCATAGG - Intronic
988931874 5:36043643-36043665 TTTTAGCTCTGATTTTATTTGGG - Intronic
989053697 5:37345985-37346007 TTTTCCCTCTAATTTTTTTCTGG - Intronic
989187477 5:38639021-38639043 TTTTTCCTCTGATTTTGTTATGG - Intergenic
989403419 5:41033864-41033886 TTTTGCCTTTGATTTTTTTTAGG - Exonic
989472357 5:41835115-41835137 TTTCATCTCTGATTTTATTTGGG - Intronic
989576783 5:42995284-42995306 TTTTCTCGCTGTTTTTCTGTCGG + Intergenic
990435511 5:55786799-55786821 TTTTGCTTCTGATTTTTATTAGG + Intronic
990668274 5:58098106-58098128 TTTTCTCACTGATTTTATTGAGG + Intergenic
990809780 5:59709906-59709928 TTTTCCCCCAGATTTTCCTTAGG - Intronic
990883447 5:60565634-60565656 TTTCTCCTGTGATTTTCTTGGGG + Intergenic
990968372 5:61475201-61475223 TTTTCCCTCCTTTTTTCCTTAGG + Intronic
991065935 5:62424940-62424962 CTTTACCTCAAATTTTCTTTTGG + Intronic
991108639 5:62871364-62871386 ATTTCGCTCTCATTTCCTTTTGG + Intergenic
991150996 5:63369990-63370012 TTTTGTCTCTTATTTTTTTTAGG - Intergenic
991230463 5:64327152-64327174 TTTTGTTTCTGATTTTATTTGGG + Intronic
992136607 5:73752390-73752412 TTTTCCCTTTTGTTTTCTCTTGG + Intronic
992439884 5:76788732-76788754 TTTTGGCTGTGATTTCCTTTTGG - Intergenic
992933684 5:81678354-81678376 TTTTCCTTCTGCTTTTCAGTTGG - Intronic
993125059 5:83823867-83823889 TTTTCCCTGTAATTTTATCTAGG + Intergenic
993401981 5:87465018-87465040 TTTTATTTCTGATTTTATTTGGG + Intergenic
993494528 5:88592990-88593012 TTTTTCCCCAGATTTTCATTTGG - Intergenic
993495698 5:88606120-88606142 TTTTAGCTGTGATTTTTTTTAGG + Intergenic
993586175 5:89731788-89731810 CTTTCTTTCTGATTTTTTTTTGG - Intergenic
993845904 5:92942884-92942906 TTTTCCCTCTCAGTTTGGTTTGG + Intergenic
993999682 5:94764183-94764205 TTGTCCATGTGACTTTCTTTGGG - Intronic
994033670 5:95174179-95174201 TTATCCCTCTGATTTCTCTTTGG - Intronic
994165201 5:96600973-96600995 TTTTCCTTCTGCTTTTCTTCTGG + Intronic
994400209 5:99269844-99269866 TTTAATCTCTGATTTTATTTGGG + Intergenic
994457545 5:100031179-100031201 TTTCGTCTCTGATTTTATTTGGG - Intergenic
994530334 5:100961173-100961195 TTTTGTTTCTGATTTTATTTAGG - Intergenic
994611282 5:102044190-102044212 TTTTCGCTCTGATGTTCATCAGG - Intergenic
994720737 5:103377304-103377326 TTTTATTTCTGATTTTATTTGGG + Intergenic
994923164 5:106078754-106078776 TTTTACCTCTCTGTTTCTTTGGG + Intergenic
995069739 5:107906010-107906032 TTTTCCTTTTCAGTTTCTTTGGG - Intronic
995152360 5:108863911-108863933 CTTTCTTTCTGATTTTCTTCAGG + Intronic
995257242 5:110060918-110060940 TTTTCCCTCTGAATTACTATGGG + Intergenic
995312516 5:110730276-110730298 TTTTTCCTATGATTCACTTTTGG - Intronic
996024661 5:118631508-118631530 TTTTCCATTTAATTTTTTTTAGG + Intergenic
996038634 5:118786343-118786365 TTCTCTCTCTGGGTTTCTTTTGG - Intergenic
996201856 5:120685406-120685428 TTTTTCCTGTGATTTTCTAAAGG + Intronic
996631718 5:125640751-125640773 TTTTCATTCTTTTTTTCTTTTGG - Intergenic
996962668 5:129269973-129269995 TTTTCCCTCTGCTTTTTTCAAGG + Intergenic
997147445 5:131451873-131451895 TTTTTGATCTGATTTCCTTTTGG - Intronic
997224705 5:132200536-132200558 TTTTCTCTCTCCTTTTTTTTGGG + Intronic
997626476 5:135334556-135334578 TTTTTACTCTAATGTTCTTTTGG - Exonic
997629211 5:135353953-135353975 TATTCCCCTTGCTTTTCTTTAGG + Intronic
997776355 5:136610522-136610544 TTTCCTCTCTAATTTTATTTGGG - Intergenic
998567982 5:143233033-143233055 TTTTCCTTCTGGTTTTGATTTGG + Intergenic
998663812 5:144272627-144272649 TTTTCATTCTGATATTCTATGGG - Intronic
999047962 5:148489986-148490008 CTCTGCCTCTGGTTTTCTTTTGG - Intronic
999493600 5:152075115-152075137 TTTTGCCTCTGAGTTTCTGTTGG + Intergenic
999999625 5:157125504-157125526 TTTTATTTCTGATTTTATTTGGG - Intronic
1000307208 5:160005662-160005684 GTTTCCCTCTTTTTTTTTTTTGG - Intergenic
1000539048 5:162516489-162516511 TTTTATCTCTGATATTATTTGGG + Intergenic
1000622287 5:163499485-163499507 TTTTCCTTCAGTTTGTCTTTTGG + Intergenic
1000843031 5:166245440-166245462 TTTTTCTTCTTATTTTTTTTTGG + Intergenic
1000858473 5:166429218-166429240 ATTTTCCTCTCATTTTCCTTAGG - Intergenic
1001319402 5:170668060-170668082 TATTACCTGTGATTTCCTTTAGG - Intronic
1001417880 5:171560509-171560531 ATGTCCCTCTTATTTTCTTTGGG + Intergenic
1001735979 5:174001863-174001885 ATGTACCTCTGGTTTTCTTTAGG + Intronic
1001872923 5:175172552-175172574 TTTTCCTTCTGAACTTCTGTAGG - Intergenic
1001915150 5:175554149-175554171 TTTTCACTCTGTATTTCTTATGG - Intergenic
1002371066 5:178755173-178755195 ATTTCACTCAGATCTTCTTTGGG - Intergenic
1003271589 6:4612519-4612541 TTTCTCCTCTCATTTTCTGTTGG - Intergenic
1003759806 6:9165339-9165361 TTTTCCCTTCTATTTTCATTGGG - Intergenic
1003774904 6:9349345-9349367 TTTTCCCTTTGATTTCTTCTTGG + Intergenic
1003912299 6:10753458-10753480 TTTATCCTCTCATTCTCTTTTGG + Intronic
1004203858 6:13574161-13574183 TTGTCTCTCTGTTTTTATTTGGG - Intergenic
1004693952 6:18016816-18016838 TCTTTCCTCTGAATGTCTTTGGG + Intergenic
1004714626 6:18205398-18205420 TTTCCCCTCTGACTTTACTTGGG + Intronic
1004731384 6:18362618-18362640 TTTTACCTATGGTTTTATTTGGG + Intergenic
1005531820 6:26715147-26715169 GTTTCCCTTTTATTTTCATTTGG - Intergenic
1005538975 6:26786518-26786540 GTTTCCCTTTTATTTTCATTTGG + Intergenic
1005544178 6:26846883-26846905 TTTTTTCTCAGTTTTTCTTTTGG - Intergenic
1005641852 6:27803688-27803710 TTTTGCATCTTAGTTTCTTTGGG + Intergenic
1006201519 6:32296485-32296507 TATTACCACTGATTTTCATTAGG - Intronic
1006242861 6:32701074-32701096 TTTTCCCTCTCATTGTTTTCTGG + Intergenic
1006953854 6:37849290-37849312 TTTCCCCTCTCTTCTTCTTTGGG + Intronic
1007182510 6:39940082-39940104 TTTTTCCCCTGTTTTTGTTTTGG + Intergenic
1007190351 6:40011057-40011079 ATTTTCATCTGATTTTATTTGGG + Intergenic
1007519401 6:42439811-42439833 TTATCCCTCTGACTTTGTTTGGG - Intronic
1007643317 6:43361210-43361232 TTTTCCCTCTGATTTTCTTTAGG - Intronic
1008753201 6:54761959-54761981 TTCTCCCTCTGATTTCATGTAGG - Intergenic
1009009814 6:57828745-57828767 GTTTCCCTTTTATTTTCATTTGG + Intergenic
1009014961 6:57888510-57888532 TTTTTTCTCAGTTTTTCTTTTGG - Intergenic
1009231448 6:61066936-61066958 GTTTCTCTCTGTTTTTCTCTGGG + Intergenic
1009568500 6:65347575-65347597 TTTTCCCTTTGAGTTTTTGTGGG + Intronic
1009802262 6:68553590-68553612 TTTCATCTCTGATTTTATTTGGG - Intergenic
1009819393 6:68780473-68780495 TTTTCCTCCTGACTTCCTTTGGG - Intronic
1009950040 6:70384942-70384964 TTTTCCCTATGTTTTTTTCTAGG + Intergenic
1009954197 6:70432796-70432818 TTTTCCTTATAATTCTCTTTAGG + Intronic
1010274691 6:73955894-73955916 TTTTACCTCTGTTTTCGTTTTGG + Intergenic
1010306889 6:74335154-74335176 TTTTCCCTTACATTTTTTTTGGG + Intergenic
1010363840 6:75027119-75027141 TTTTACCTCTTATGTTCTCTGGG + Intergenic
1010384682 6:75265338-75265360 TTTTCCCTCTCTGTTTCTCTAGG - Exonic
1010404491 6:75487658-75487680 TTTTCAGTCAGATCTTCTTTTGG + Intronic
1010624506 6:78120898-78120920 TTTTCCCTGTGTTTTTCTTTTGG + Intergenic
1010915613 6:81614243-81614265 TTTGCACTGTGATTTGCTTTTGG + Intronic
1011141870 6:84166993-84167015 TTTTTCCCCTGATTTCTTTTAGG + Intronic
1011385955 6:86798009-86798031 TTTCATCTCTGATTTTATTTAGG + Intergenic
1011447340 6:87455649-87455671 TTTTATCTTTGATTTTCTTTGGG - Intronic
1011609026 6:89132401-89132423 TTTTCCTTCTCATTCTCTTTTGG + Intergenic
1012067653 6:94569200-94569222 TTTTCCCTTTTTTTTTTTTTGGG - Intergenic
1012177012 6:96100086-96100108 TGTTCCTTCTGATTTCCCTTGGG - Intronic
1012468969 6:99548474-99548496 TTTCCCCTCTTATTTTCCATTGG - Intronic
1013144544 6:107375200-107375222 TTTTCCTTCTGCTTTTTTTAGGG - Intronic
1013675199 6:112452021-112452043 TTTGTCCTGTGCTTTTCTTTGGG + Intergenic
1013689429 6:112623107-112623129 TTTTCCCTTTTATCTTCATTTGG + Intergenic
1013703420 6:112801711-112801733 TTTTCCCTATTATTTGTTTTGGG - Intergenic
1013791547 6:113843064-113843086 TTTACACCCTGAATTTCTTTGGG - Intergenic
1014151940 6:118067412-118067434 TTTTCCCTCTGACTCTCCCTGGG - Intronic
1014422685 6:121264637-121264659 TTTTCACACTGATGTTCATTAGG - Intronic
1014755108 6:125293909-125293931 TTTTGTCTCTGCTTTTCATTAGG - Intronic
1014773313 6:125481357-125481379 TTTTGTTTCTGCTTTTCTTTGGG - Intergenic
1015334146 6:132017050-132017072 TTTTCACTCATTTTTTCTTTTGG + Intergenic
1015578390 6:134697522-134697544 TTTTATCTCTGATTTTATTTGGG + Intergenic
1015753404 6:136584057-136584079 TTTTCTCTCTGATTATTTCTTGG - Intronic
1015909171 6:138149634-138149656 TTCTCCCTTTTTTTTTCTTTAGG + Intergenic
1016258027 6:142132697-142132719 TTTTCCTTTTTATTTTATTTAGG - Intergenic
1016520294 6:144939228-144939250 TTTTCACTCAGATTTTGTGTAGG + Intergenic
1016615933 6:146048500-146048522 TTTGCCCTCTGTTTTTGTTATGG + Intronic
1016738305 6:147504395-147504417 TTTTCCCATTGATTTTCATTAGG + Intergenic
1016962045 6:149683305-149683327 TTTTCACTCTCATCTTCCTTGGG + Exonic
1017021941 6:150147000-150147022 TTTTCCATCTCATCTTCTCTTGG + Intronic
1017405025 6:154110178-154110200 TTTTCCCTTTTGTTTTATTTGGG + Intronic
1017436932 6:154424619-154424641 TATTCCCTTTGATTTTATCTAGG + Intronic
1017464672 6:154683743-154683765 TTTTTTCTCTGCTTTTCTTATGG - Intergenic
1018489403 6:164276148-164276170 TTTTCCCTCACATTTGCTTCAGG + Intergenic
1018690424 6:166339816-166339838 TTTGACCTCTGGTTTTCTCTAGG - Intronic
1018948162 6:168360949-168360971 TTTTGCCTATGCTTTTCTCTAGG - Intergenic
1019690392 7:2407482-2407504 TTTTCCCTATTTTTTTCTTCTGG - Intronic
1019750242 7:2724659-2724681 TTCTCCCTTTGGTTTTCTTTCGG - Intronic
1019809381 7:3153566-3153588 TTTTTCCTCTCTCTTTCTTTTGG + Intronic
1019837026 7:3398194-3398216 TTTTCTCCTTTATTTTCTTTGGG + Intronic
1020146179 7:5645331-5645353 TTTGCTCTCTGCTCTTCTTTGGG + Intronic
1020418715 7:7975090-7975112 ATTTCCCTCTGCTCTTCATTTGG + Intronic
1020512645 7:9077603-9077625 TTTCTCCTCTGCTTTCCTTTAGG - Intergenic
1020562883 7:9753399-9753421 TTTTCCCTATGTTTTCTTTTAGG + Intergenic
1020912708 7:14153113-14153135 TCTTCCCTCTGATTTTAGTTGGG - Intronic
1021198815 7:17703775-17703797 TTTCTCCTGTGTTTTTCTTTAGG - Intergenic
1021269636 7:18569854-18569876 TTTTCCTTCAGTTTTTTTTTAGG - Intronic
1021423575 7:20473056-20473078 TTTTGGCTCTGATTTTGTCTTGG + Intergenic
1021528567 7:21617597-21617619 TTTTTCCTCCACTTTTCTTTAGG + Exonic
1021777818 7:24071086-24071108 TTTTCCCTTTTGTTGTCTTTTGG + Intergenic
1021798459 7:24281362-24281384 TTTTCCTTCATATTTTATTTTGG - Intergenic
1021863624 7:24932400-24932422 TTTTCCCTTTCATTTTCTCTAGG - Intronic
1021953074 7:25794861-25794883 TCAACCCTCTGATTTTCCTTTGG + Intergenic
1022024662 7:26435921-26435943 TTTTCCCTCACAGTTTCTGTCGG - Intergenic
1022208755 7:28187830-28187852 TTTGCCCTCTGCTTCTCTATTGG + Intergenic
1022261652 7:28711277-28711299 TTCCCCATCTGCTTTTCTTTTGG - Intronic
1022550523 7:31235121-31235143 TCTTCCCTTTGACTTTCTTTAGG + Intergenic
1022663707 7:32388987-32389009 ATTTAGCTGTGATTTTCTTTTGG - Intergenic
1023073431 7:36460052-36460074 TTTTTCCTCTAGTTTTGTTTTGG + Intergenic
1023080772 7:36524138-36524160 TTTTCCCTTTATTTTTATTTGGG + Intronic
1023130271 7:36996135-36996157 TATTCCCTTTCCTTTTCTTTTGG + Intronic
1023413095 7:39907397-39907419 TTTTGCTTTTGATTTTATTTGGG - Intergenic
1023619960 7:42060689-42060711 TTTTGCCTTGTATTTTCTTTTGG - Intronic
1023776360 7:43611256-43611278 TTTTCCCTGTATTTTTCTGTAGG - Intronic
1023952444 7:44857362-44857384 TTTTCCCTTTGATTTTTTCAAGG + Intergenic
1024499003 7:50081645-50081667 TTTTTCTTGTGATTTCCTTTTGG - Intronic
1024731890 7:52262409-52262431 TTTTTCCACTGACTTCCTTTTGG + Intergenic
1026439193 7:70428597-70428619 ATTTTCCTCTCATTTCCTTTAGG + Intronic
1026548240 7:71343884-71343906 TTTTCTCTGTGGTGTTCTTTTGG + Intronic
1027009923 7:74735647-74735669 TTTTCCCTGTTTTTTTTTTTTGG + Intronic
1027299170 7:76811783-76811805 CTTTCTGTCTCATTTTCTTTTGG - Intergenic
1027641767 7:80743600-80743622 TTTTCCATCTAATTTTTATTTGG + Exonic
1027684126 7:81260356-81260378 TTTTCCATCTGGCTTCCTTTAGG + Intergenic
1027776994 7:82478233-82478255 TTGTTCTTCTGATTTTATTTAGG + Intergenic
1027988566 7:85328173-85328195 TAATCCCTCTAATTTTCTTTAGG - Intergenic
1028634926 7:92977289-92977311 TCTTCCCTCTGTTTTATTTTTGG + Intergenic
1029042755 7:97594918-97594940 TCTTCCTTCAGATTTTATTTTGG + Intergenic
1029266099 7:99341736-99341758 TTTTCCCTCTACTTCTCTTTTGG + Intronic
1029351030 7:100013018-100013040 TATTCCCTCTGACTATCTGTGGG + Intergenic
1029806221 7:102999765-102999787 TTTTGTCTCTGATTTTATTTGGG + Intronic
1030518704 7:110569504-110569526 TTTTTGTCCTGATTTTCTTTTGG - Intergenic
1030583242 7:111385708-111385730 TTTTCCATCAGCTTTTCTTATGG - Intronic
1030902153 7:115137913-115137935 TTTTCAGTTGGATTTTCTTTAGG - Intergenic
1030975096 7:116111994-116112016 TTTACTTTCTGATTTTCTCTAGG + Intronic
1031169820 7:118278723-118278745 TTTTTACTCCGATATTCTTTGGG + Intergenic
1031257577 7:119474618-119474640 ATTTCCATTTGATTTTATTTAGG + Intergenic
1031282860 7:119826509-119826531 TATACCCTCTTATTTTCTTAAGG - Intergenic
1031487784 7:122350591-122350613 ATTTCCATCTGGTTTTCTGTGGG - Intronic
1031682914 7:124696357-124696379 TTTTAACTCTGATTTTCTCTGGG - Intergenic
1032136361 7:129282411-129282433 TTTCCACTCTGGTTTACTTTGGG + Intronic
1032138403 7:129303511-129303533 TTTCATCTCTGATTTTATTTTGG + Intronic
1032162771 7:129523389-129523411 TTTTTCCTCTCACTTTTTTTTGG + Intergenic
1032259135 7:130320710-130320732 TTTTCCATCTGTATTTCCTTAGG + Intronic
1032271721 7:130414474-130414496 TTTATCCACTGATATTCTTTTGG + Intronic
1032437405 7:131911385-131911407 GTTTCCCTCTCTTTTTCTTCAGG + Intergenic
1032773644 7:135087194-135087216 TTTTCATTCTGATTTTATTTGGG + Intronic
1033256344 7:139804917-139804939 TTTTCCCTCTTAATATATTTTGG + Intronic
1033563416 7:142555794-142555816 TTTTCCTTCTGTTTTATTTTTGG + Intergenic
1033999593 7:147395860-147395882 TTTTAACTTTAATTTTCTTTTGG - Intronic
1034317917 7:150151057-150151079 TTTTCCTTCTAATTATTTTTTGG + Intergenic
1034608647 7:152343668-152343690 TTTTCCCTCTGACCTCTTTTAGG - Intronic
1034774834 7:153816188-153816210 TTTTCCTTCTAATTATTTTTTGG - Intergenic
1035723394 8:1809939-1809961 TTTTCCCTTTGGTTTACTTTCGG - Intergenic
1035946813 8:3972493-3972515 TTTTGCCTCTGTCATTCTTTAGG + Intronic
1036163978 8:6414373-6414395 TGTTGCCTCTGAATTTCATTTGG + Intronic
1036177410 8:6552069-6552091 CATTTCCTCTGATTTTCTTTGGG - Intronic
1036190559 8:6666133-6666155 TTCACCCTCTGTTTTTCTTAGGG - Intergenic
1036940132 8:13043888-13043910 TTTTCCGTCTGTTTTTGTTCTGG - Intergenic
1036944734 8:13084081-13084103 TTATACCTCAGATATTCTTTTGG - Exonic
1036989083 8:13571191-13571213 TTTTCCTTTTGTTTTTCTTGGGG + Intergenic
1037046271 8:14308231-14308253 GTTTCCCTCTAATTTTCCTTTGG - Intronic
1037190753 8:16122278-16122300 TTTTCTTTCTCGTTTTCTTTAGG - Intronic
1037272500 8:17145261-17145283 CTTTCCCTGTGTTCTTCTTTAGG + Intergenic
1037526237 8:19727166-19727188 TAAGCCCTCTGATTTCCTTTTGG - Intronic
1037798022 8:22012866-22012888 TTTTCCTACTGAATTACTTTGGG - Intergenic
1038204205 8:25449294-25449316 TTTTCCCTCTTATTTACCTCTGG + Intronic
1038338839 8:26667202-26667224 CTTTCACACTGATTTTCCTTTGG - Intergenic
1038542364 8:28400708-28400730 TATTCCCTGTGGTTTTTTTTGGG - Intronic
1038833541 8:31091910-31091932 TTTTCCCTCAACTTTTATTTTGG + Intronic
1038974573 8:32679124-32679146 TTTTTCCTTTTATTTTATTTTGG - Intronic
1039444751 8:37622079-37622101 TTTTCTTTCTTTTTTTCTTTTGG + Intergenic
1039546789 8:38416209-38416231 TTATTTCTCTGATTTTTTTTGGG - Intronic
1039646968 8:39296812-39296834 TCTTCTCTTTGATTTTTTTTTGG + Intergenic
1040574728 8:48641808-48641830 TTTCCCACCTCATTTTCTTTGGG + Intergenic
1040920679 8:52613005-52613027 TCTTCCCTCTGTTTTTCTTTGGG - Intergenic
1041515355 8:58693288-58693310 TTTTCCTTTTTTTTTTCTTTAGG - Intergenic
1041639862 8:60185362-60185384 TTTTCTCTCTCCTTTTCTTCTGG - Intergenic
1041816024 8:61972277-61972299 TTTTACCTCTGACTTTACTTTGG - Intergenic
1042124171 8:65520653-65520675 TTTTCTCATTGAATTTCTTTTGG + Intergenic
1042397061 8:68305272-68305294 TTTTCCATCTCTTTGTCTTTTGG - Intronic
1043694106 8:83198184-83198206 TTTTCCATTTGATTTGCTTCCGG - Intergenic
1043994762 8:86799433-86799455 CTTTCCCTCTAGTTTTCATTTGG + Intergenic
1044025859 8:87171375-87171397 TTTTATCTTTGATTTTATTTGGG + Intronic
1044182652 8:89215136-89215158 TTTTCCCTCTACTGTTCTTGTGG - Intergenic
1044454773 8:92380844-92380866 TGTTCACTGTGATTATCTTTGGG + Intergenic
1045206823 8:100051110-100051132 CTTTCCCTCTCACTTCCTTTAGG - Intronic
1045440384 8:102202874-102202896 TTTTGAGTCTGATTTCCTTTTGG + Intergenic
1045704758 8:104909309-104909331 ATTTTCCTCTGTTTTCCTTTGGG - Intronic
1045889275 8:107135121-107135143 TTTTCCCTTTGCTGTTCTTATGG + Intergenic
1046102284 8:109628957-109628979 ATTTCCTTCTCATTTTTTTTTGG - Intronic
1046214274 8:111122591-111122613 TTTTCCATCTGATATTTTGTAGG - Intergenic
1046241793 8:111506286-111506308 TTTTCTCTCTGGATTTTTTTGGG - Intergenic
1046310619 8:112432134-112432156 TTTACCCTCTGCCTTGCTTTGGG - Intronic
1046459436 8:114514189-114514211 TATTCTGTCTGATTTTATTTTGG - Intergenic
1046530745 8:115442291-115442313 TTTACCCACTGATTTTCTGAAGG + Intronic
1046575529 8:116024097-116024119 TTTTCACTCTGATTCTTTCTTGG - Intergenic
1046776385 8:118168231-118168253 TTTACCCTCTGATGTTTGTTGGG + Intergenic
1046925419 8:119781692-119781714 TTTTTCCTCTTTTTTTTTTTTGG + Intronic
1047470733 8:125169446-125169468 TTTTCCCCATGATTTTCTCCTGG + Intronic
1047664282 8:127073545-127073567 TTTTGCTTCTGGTTTTCTATTGG - Intergenic
1047683719 8:127282094-127282116 TTTGTCATCTGACTTTCTTTTGG - Intergenic
1047917935 8:129603120-129603142 TTTTCCCTCTGATTTGGGTGGGG + Intergenic
1047955472 8:129972036-129972058 TTTTCTCTTTGCTTTTCATTGGG + Intronic
1047992696 8:130302850-130302872 CTTTCCATCTGATTGTCTTCTGG - Intronic
1048021721 8:130545881-130545903 TTTCACCTTTGAGTTTCTTTGGG - Intergenic
1048131404 8:131701786-131701808 TTCTCTCTTTGATCTTCTTTTGG + Intergenic
1048351471 8:133620014-133620036 TTTTCCCTCTGGGTCTCTTCAGG - Intergenic
1048391131 8:133965929-133965951 CTGACCCTCTGATTCTCTTTAGG - Intergenic
1048644234 8:136400234-136400256 TTTTCCATCTCTTTTTCTTCTGG - Intergenic
1048677665 8:136801601-136801623 TATTCTCTGTTATTTTCTTTGGG + Intergenic
1048710873 8:137208919-137208941 TTTTTTCTCTGATTTACCTTTGG - Intergenic
1049206404 8:141365632-141365654 TCTTCCCTCTGATTGTCCTGAGG - Intronic
1049335884 8:142084863-142084885 ATTTCTCTCTAATTTTTTTTTGG - Intergenic
1050534127 9:6616825-6616847 TTTTGGCTGTGACTTTCTTTTGG + Intronic
1050641848 9:7676852-7676874 TTTTCTCTCTCATTTTCTCTGGG + Intergenic
1050727815 9:8672319-8672341 TTTTCCCTTTAATTTGCATTTGG - Intronic
1050762691 9:9091990-9092012 TTTTCTCTCAGTTTATCTTTGGG + Intronic
1050823780 9:9917333-9917355 TTTTATTTCTGATTTTATTTAGG - Intronic
1050978490 9:11974588-11974610 TTATCCCTCTGATTTTAGTGTGG - Intergenic
1051133141 9:13885238-13885260 TTCTCTCTCTCATTTTCTTGTGG - Intergenic
1051359246 9:16267233-16267255 TTCTCTCTCTCTTTTTCTTTGGG - Intronic
1051527445 9:18062806-18062828 TTTTCCCTCTGATTTATGGTTGG + Intergenic
1051751559 9:20347780-20347802 ACTTACCTCTGATTCTCTTTAGG + Intronic
1051753989 9:20375462-20375484 TTTTACCACTGGTTTGCTTTGGG - Intronic
1051942830 9:22529633-22529655 ATTTCCCTCTAATTTAGTTTGGG + Intergenic
1052166372 9:25335102-25335124 GTTTGCTTCTGAATTTCTTTGGG - Intergenic
1052298016 9:26920540-26920562 TTTTAACTGTTATTTTCTTTTGG - Intronic
1052601230 9:30634959-30634981 TTTGCCTTCTGTTTTCCTTTGGG + Intergenic
1053286761 9:36854804-36854826 TCTTCCCTCTGTTTTTCTGAAGG - Intronic
1053287067 9:36856537-36856559 TTTTTCCTCTTTTTTTTTTTAGG + Intronic
1053337872 9:37293240-37293262 TTTTTCCTATAATTTTTTTTAGG - Intronic
1053564230 9:39231335-39231357 TTTTCTCTCTGATTTTAATTGGG - Intronic
1053830016 9:42069207-42069229 TTTTCTCTCTGATTTTAATTGGG - Intronic
1054132918 9:61387699-61387721 TTTTCTCTCTGATTTTAATTGGG + Intergenic
1054600540 9:67118246-67118268 TTTTCTCTCTGATTTTAATTGGG + Intergenic
1054858802 9:69928846-69928868 TTTTCCTTCTGAGTTTTCTTTGG + Intergenic
1055116783 9:72613503-72613525 TTTGCCCCCTGATTATCTTTTGG + Intronic
1055266896 9:74503606-74503628 CTTTCCCTCTAATTATCATTAGG - Intronic
1055274239 9:74596222-74596244 TCTTCCCTCTGCTGTTCTTGGGG - Intronic
1055335989 9:75234102-75234124 TATTCTCTTTTATTTTCTTTTGG + Intergenic
1055913197 9:81374436-81374458 TTTGGCCTCTGAGTTTCTGTAGG - Intergenic
1056249898 9:84737111-84737133 TTCTCTCTCTCTTTTTCTTTAGG + Intronic
1056931612 9:90882788-90882810 GTTTCCCTGTGCTTTGCTTTTGG - Intronic
1057541411 9:95975604-95975626 TTTTCACTCAAATTTTATTTTGG + Intronic
1058556321 9:106172122-106172144 TTTTTCCTCTTATTTTCCCTAGG - Intergenic
1058625751 9:106931269-106931291 TTTTCCCTCTGACTTTTATTAGG + Intronic
1058853701 9:109038728-109038750 TTTCCTCTCTGATTTTACTTTGG - Intronic
1059157739 9:112004876-112004898 TTTTCAGTCTGCTTTCCTTTGGG - Intergenic
1059778115 9:117497079-117497101 TTTTCTCTCTCTTCTTCTTTTGG + Intergenic
1060373210 9:123094677-123094699 TGTTCCCTCTTGTTTTCTTGAGG + Intronic
1060644810 9:125268914-125268936 TTTTCCTTTTTTTTTTCTTTAGG + Intronic
1060692064 9:125671638-125671660 TTTTCCCACTTATATTTTTTTGG - Intronic
1061728382 9:132594261-132594283 TGGTCCCTCTTATTTTCTTCTGG - Exonic
1185992116 X:4902840-4902862 TTTTCCCCATGATTTTGTATAGG + Intergenic
1186079783 X:5918078-5918100 TTTTCCCCCAGATTTTGCTTGGG - Intronic
1186149817 X:6662460-6662482 TTTTCCCTCTTATTCATTTTAGG - Intergenic
1186821643 X:13294055-13294077 TCTTCCCCGTGTTTTTCTTTGGG - Intergenic
1187040316 X:15588079-15588101 TTTTGCATCTGCTTTTATTTTGG - Intronic
1187489526 X:19737807-19737829 TTTTCCCTCTGATCATTTCTTGG - Intronic
1187538169 X:20163475-20163497 TTTCCCATCAGATTTTTTTTTGG - Intronic
1187616797 X:21004080-21004102 TTTGGCCTCTGAGTTTCCTTTGG - Intergenic
1187775969 X:22757635-22757657 CTTTCCCTCTGAATTTTCTTGGG - Intergenic
1187996483 X:24932442-24932464 TATTTCCTCTTATTTTCTGTGGG - Intronic
1188529398 X:31122530-31122552 TTTTCTCTCTGCTTTTACTTGGG + Intronic
1188544951 X:31294828-31294850 TTTTACATCTGATTTCCATTTGG - Intronic
1188678824 X:32976532-32976554 TTTTCCCTTTGATTTATTGTGGG - Intronic
1188933968 X:36150765-36150787 TTTTTCCTCAGGTTTACTTTAGG - Intergenic
1189123565 X:38421922-38421944 TTTTTCCTCTAATTTTTCTTTGG + Intronic
1189410540 X:40766625-40766647 ATTTCTCTCTGTATTTCTTTAGG - Intergenic
1189698403 X:43690512-43690534 TTTTTCTGCTTATTTTCTTTTGG + Intronic
1189732562 X:44036851-44036873 TTTTCCCTTTCATTTTCCATAGG + Intergenic
1189806243 X:44738177-44738199 TTTTCCCTCTTCTTTACTGTTGG + Intergenic
1189997307 X:46651420-46651442 TTTTTCCATTGATTTTTTTTGGG - Intronic
1191043347 X:56108885-56108907 TTTTGCTTTTCATTTTCTTTGGG + Intergenic
1191100936 X:56727888-56727910 TTTTCCTTTAGATTTTCTCTTGG + Intergenic
1191771262 X:64761420-64761442 TTTTCGCACTGATGTTCTTCAGG + Intergenic
1192179162 X:68905210-68905232 TTTCAGCTCTGATTTTCTTGAGG + Intergenic
1192179322 X:68906485-68906507 TTTCAGCTCTGATTTTCTTGAGG + Intergenic
1192632981 X:72791280-72791302 TCTTCTCTCTGTTTTTCTGTAGG + Intronic
1192648728 X:72929521-72929543 TCTTCTCTCTGTTTTTCTGTAGG - Intronic
1192997179 X:76524236-76524258 TTTTCCCATTGATTTTCATCAGG + Intergenic
1193183414 X:78484545-78484567 TTTTCCCTGTGCTGTTCTTCTGG - Intergenic
1193289611 X:79756192-79756214 TTTTCCCTCAAATTTGCTTCTGG + Intergenic
1193302533 X:79907387-79907409 TTTCAGCTCTGATTTTATTTTGG - Intergenic
1193310764 X:80007143-80007165 GTTTTCATCTGATTATCTTTTGG - Intergenic
1193582262 X:83280721-83280743 TCTTCTCTCTGTTTTTCCTTGGG - Intergenic
1193836089 X:86345855-86345877 TTTTCCCTGTTCTTTTATTTAGG - Intronic
1194346827 X:92775247-92775269 TTTTTCCCCTTAATTTCTTTGGG - Intergenic
1194431757 X:93816560-93816582 TTTCATCTCTGATTTTATTTGGG - Intergenic
1194811615 X:98394388-98394410 TTTTCCCACTGATGTTCACTAGG - Intergenic
1194889233 X:99356706-99356728 TGTTCCCTCTTATTTCCTTGAGG - Intergenic
1195136204 X:101909374-101909396 TTTTCCCTCTGCTTTTCTAAAGG - Intronic
1195274210 X:103264187-103264209 TTCTTGCTCTGATTTTCATTGGG + Intergenic
1195447310 X:104969046-104969068 TTTTCCTTCTGTATTTATTTTGG - Intronic
1195528872 X:105928344-105928366 TTTTGTTTCTGATTTTATTTGGG + Intronic
1195528951 X:105930031-105930053 GTTTCACTGTGATTTTCTTTGGG + Intronic
1196317769 X:114249297-114249319 TCTTTTTTCTGATTTTCTTTTGG - Intergenic
1196385398 X:115143268-115143290 TTTCATCTCTGATTTTATTTGGG - Intronic
1196532288 X:116802660-116802682 TTTCATCTCTGATTTTATTTGGG + Intergenic
1196919992 X:120575645-120575667 TTTTCGTTTTGTTTTTCTTTTGG - Exonic
1197011047 X:121563937-121563959 TTTTCCCACTAGTTTTCTTTGGG + Intergenic
1197061978 X:122192039-122192061 TTTTCCCACTGATGTTCATCAGG + Intergenic
1197096681 X:122604586-122604608 TTTTCCCTCTGCTTTTCTCAAGG - Intergenic
1197389714 X:125845236-125845258 TTCTCCCTTTCCTTTTCTTTTGG + Intergenic
1197656918 X:129126778-129126800 TTTTGCCTCTGTTTTCCTTTTGG + Intergenic
1197862546 X:130985599-130985621 TTTTTCCTGTGGTTTTCTCTTGG + Intergenic
1197983552 X:132243924-132243946 TTTACCCTCTTAGTTTCTTTTGG - Intergenic
1198630172 X:138628682-138628704 TTTTCCCTCATATGTTCATTTGG + Intergenic
1198797721 X:140416656-140416678 TTTTCCTTCAGGTTTTCTTCAGG + Intergenic
1199674823 X:150179454-150179476 TTTTCTCTCTGTGTTTCATTTGG + Intergenic
1200319328 X:155169693-155169715 TTTTCCTTTTGATTTCCTCTTGG - Intergenic
1200655159 Y:5891891-5891913 TTTTTCCCCTTAATTTCTTTGGG - Intergenic
1200743971 Y:6886160-6886182 TTTTCTTTATGATTTTCTTTAGG - Intergenic