ID: 1007643318

View in Genome Browser
Species Human (GRCh38)
Location 6:43361237-43361259
Sequence TTCTGACAGATTGAAGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007643318_1007643325 15 Left 1007643318 6:43361237-43361259 CCCACTCCTTCAATCTGTCAGAA 0: 1
1: 0
2: 2
3: 17
4: 200
Right 1007643325 6:43361275-43361297 AGGCGATAAGCTGGGCACAATGG No data
1007643318_1007643322 -5 Left 1007643318 6:43361237-43361259 CCCACTCCTTCAATCTGTCAGAA 0: 1
1: 0
2: 2
3: 17
4: 200
Right 1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG No data
1007643318_1007643323 6 Left 1007643318 6:43361237-43361259 CCCACTCCTTCAATCTGTCAGAA 0: 1
1: 0
2: 2
3: 17
4: 200
Right 1007643323 6:43361266-43361288 GAAGAAATTAGGCGATAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 91
1007643318_1007643324 7 Left 1007643318 6:43361237-43361259 CCCACTCCTTCAATCTGTCAGAA 0: 1
1: 0
2: 2
3: 17
4: 200
Right 1007643324 6:43361267-43361289 AAGAAATTAGGCGATAAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007643318 Original CRISPR TTCTGACAGATTGAAGGAGT GGG (reversed) Intronic
901267388 1:7922008-7922030 TCCTAACAGATGGAAGCAGTGGG - Intronic
901333882 1:8431908-8431930 TGGTGACTGATGGAAGGAGTGGG - Intronic
902590089 1:17467675-17467697 TTCTCACAGGTTGGAGGAGCTGG - Intergenic
902727594 1:18347410-18347432 TCCTGACAGCTTCATGGAGTGGG - Intronic
905204642 1:36336318-36336340 TTATGACAGGTCCAAGGAGTGGG - Intergenic
905217486 1:36419321-36419343 CACTGGCAGATTGAAGGAGCTGG - Intronic
906277374 1:44526593-44526615 TGGTGCCAGATTGAAGGAGGAGG - Intronic
907502539 1:54892301-54892323 TGGAGACAGATTGAAGGAGAAGG + Intergenic
907794373 1:57700143-57700165 TGGGGACAGAGTGAAGGAGTCGG - Intronic
907805879 1:57819445-57819467 TTTTTAGAGATTTAAGGAGTGGG + Intronic
908662504 1:66452309-66452331 TGCTAACAGATTGAAGGAAAAGG - Intergenic
909354345 1:74690342-74690364 TGCTGAAATATTGAAGGAGGAGG + Intergenic
911001757 1:93173103-93173125 TTCTGATAGACAGAAGGAATAGG + Intronic
911283349 1:95958853-95958875 TTTAGACAGATTGAATGATTAGG - Intergenic
914455459 1:147832780-147832802 TTCTGTCAGAGTGAAGGTCTAGG + Intergenic
918177147 1:182056700-182056722 CTCGGACAGATTGGAGGACTTGG + Exonic
918625492 1:186652150-186652172 TACAGACAGATTTGAGGAGTGGG - Intergenic
919104083 1:193127708-193127730 ATTTGCCAGATTGAAAGAGTAGG + Intronic
923784513 1:237054335-237054357 TCCTGACAGATGGAGGGAGGGGG - Intronic
924086007 1:240452325-240452347 TTCTGACTAATTAAAGGAGTGGG - Intronic
1062951084 10:1504056-1504078 TACTGGCAGAGTGAAGGATTGGG - Intronic
1063040165 10:2329658-2329680 TTCTGACGGAGGGAAGGGGTTGG + Intergenic
1063833979 10:9990930-9990952 TTCTGGTAGATTGAACGTGTGGG - Intergenic
1063943644 10:11156613-11156635 GTCTGACAAATTCAAGGAGCTGG - Intronic
1064505773 10:16028143-16028165 TTTTGACAAATTGAAGGTTTCGG + Intergenic
1065276632 10:24092834-24092856 TTCTGACAAATACAAAGAGTTGG - Intronic
1066004171 10:31132308-31132330 CTCTGAGAGATAGAAGGAGCTGG - Intergenic
1066076661 10:31885388-31885410 TTCTGACTGATGGAGGGAGGAGG - Intronic
1068632476 10:59311924-59311946 TTCTGATAGATAGGAGGAGCTGG - Intronic
1070844788 10:79513255-79513277 CCCTGACAGATTGAGGGGGTGGG - Exonic
1070929016 10:80247056-80247078 CCCTGACAGATTGAGGGGGTGGG + Intergenic
1071534625 10:86417741-86417763 TTCCTAAAGAATGAAGGAGTGGG + Intergenic
1075509322 10:123056987-123057009 TTCTGAAAGAGTGAATGAGTGGG - Exonic
1077876968 11:6317290-6317312 TAGTGACTGAATGAAGGAGTAGG + Intergenic
1078236569 11:9490527-9490549 TTTTGAGAGATTGAAGCAGGTGG - Intronic
1078968074 11:16370782-16370804 TTCTGACAGATTGGATTTGTTGG - Intronic
1079319667 11:19441592-19441614 ATAAGACAGAATGAAGGAGTGGG - Intronic
1081060110 11:38463723-38463745 TGCTGCCTGACTGAAGGAGTAGG + Intergenic
1081515392 11:43823901-43823923 TTCTGGCAGATTCAAAGATTAGG - Intronic
1081651200 11:44825251-44825273 TTCTGACACATGGAAGGTGCTGG - Intronic
1083293393 11:61702286-61702308 TTCTGACAGATTTCAAAAGTGGG + Intronic
1084011647 11:66353446-66353468 TTTTTACAGATTGAAGGTGGCGG + Intronic
1084595343 11:70113468-70113490 GCCTGACAGAATGGAGGAGTGGG - Intronic
1085251519 11:75147265-75147287 TGCTGAGAGATGGAGGGAGTTGG + Intronic
1086162996 11:83744251-83744273 TGCTGAATAATTGAAGGAGTGGG - Intronic
1086461662 11:87011850-87011872 TTCTGAGAGGTTGAAGCAGGTGG + Intergenic
1087831989 11:102829408-102829430 TTCTGTAAAATTGAAGAAGTTGG - Intergenic
1089791694 11:120949842-120949864 TACTGACAGATGGAAGAACTGGG - Intronic
1090129018 11:124119739-124119761 TATTGACAGATTGAAGTAATTGG + Intronic
1091230254 11:133983730-133983752 TTCTTACATAATGAAGGAGGAGG - Intergenic
1091842109 12:3628637-3628659 TTCTTACAGGATGCAGGAGTGGG - Intronic
1091877136 12:3944685-3944707 TCCTGACAGAATGAAGAGGTGGG + Intergenic
1091979171 12:4851663-4851685 TCCTGACAAAATGAAGGACTAGG + Intronic
1092766495 12:11857752-11857774 TTCTGGCAGAATGAAGGGTTAGG - Intronic
1093117487 12:15228896-15228918 TTCTTACATATTGAGGGATTTGG + Intronic
1093852848 12:24061724-24061746 TTCTGTCATATTGAAGCAATAGG - Intergenic
1093956538 12:25226765-25226787 TTTTGAAAGATTGAAGAATTTGG - Intronic
1096023121 12:48338584-48338606 TTCTGACAGATTCAGGCTGTGGG - Exonic
1101043826 12:100784241-100784263 TTCTGGCAGGTAGAAGAAGTTGG - Intronic
1106127708 13:26913876-26913898 TTCTGACTGATAGAAGAATTTGG - Intergenic
1106925856 13:34612423-34612445 CTTTAAGAGATTGAAGGAGTTGG - Intergenic
1109939710 13:69345639-69345661 TTCTGACAGCATTAAGGAGCAGG - Intergenic
1115091128 14:29577212-29577234 TTTTGACAGATTATAGGAGATGG + Exonic
1118057974 14:62102202-62102224 TTTTGACAGATTGTAAGCGTAGG + Exonic
1119252957 14:73172879-73172901 TTCTGACAGTAGGAAGGAGTAGG + Intronic
1119667095 14:76492672-76492694 GACTGAAAGATTCAAGGAGTGGG - Intronic
1122810871 14:104287293-104287315 TTCTGCCAGACTGAAGGGGTGGG + Intergenic
1129249548 15:74301335-74301357 TTCTGACAGGCTGGAGGAATGGG - Intronic
1129683950 15:77674187-77674209 TGCTGACAGATTGGATGAGGTGG - Intronic
1130282842 15:82532686-82532708 TGCTGACAGATAGAGGAAGTGGG + Intergenic
1133810442 16:9157314-9157336 TTCTGATGGATTGAAGTGGTGGG + Intergenic
1134748851 16:16609669-16609691 TTCTGACAGAGGGCAGGAGCCGG - Intergenic
1134996614 16:18743949-18743971 TTCTGACAGAGGGCAGGAGCCGG + Intergenic
1138047077 16:53736478-53736500 TGCTGACAGATTGAAAGACTTGG - Intronic
1138807523 16:60108195-60108217 ATCTGACTGATTGCAGGAGGGGG + Intergenic
1139224447 16:65220708-65220730 TTCTGACAGTTTGAAAGAAGAGG + Intergenic
1139933469 16:70549258-70549280 ATGAAACAGATTGAAGGAGTTGG + Intronic
1140762028 16:78118319-78118341 TTCTGACAGATAAAAGGATTTGG + Intronic
1148836345 17:50467802-50467824 TTCTTACATATAAAAGGAGTGGG - Intronic
1149205280 17:54237203-54237225 TTCTTAAAAATTGAAGGAATAGG + Intergenic
1149739263 17:59028466-59028488 CTCTGGCAGATTGCAGGATTTGG - Exonic
1149892080 17:60399062-60399084 TTAGTCCAGATTGAAGGAGTGGG + Intronic
1150500026 17:65641764-65641786 ACCTGACAGTTTGGAGGAGTAGG - Intronic
1153456425 18:5287621-5287643 TTGTGACAGATTTTAGCAGTTGG - Intergenic
1156112458 18:33744788-33744810 TTCTGACACGTTCAAGTAGTTGG - Exonic
1157115453 18:44858690-44858712 GCCTGACAGAATGAAGGAGCTGG - Intronic
1160321308 18:77898542-77898564 TTCTGACAAACTCAAAGAGTGGG - Intergenic
1165575224 19:36809705-36809727 TTTTGACAAATTGAAGGTTTTGG + Intergenic
1166147063 19:40845176-40845198 TTTTGACTGATTGAGGGAGTGGG + Intronic
1166151221 19:40877073-40877095 TTTTGACTGATTGAGGGAGTGGG + Intronic
1166179082 19:41094532-41094554 TTTTGACTGATTGAGGGAGTGGG - Intronic
1166743551 19:45129155-45129177 CCCCGACAGATTGAAGGGGTGGG - Intronic
927761263 2:25757077-25757099 TTCTAATATATTGAAGGAGAGGG + Intronic
931343018 2:61421008-61421030 TTTTGACAGATGTAAGGGGTGGG + Intronic
934070837 2:88382520-88382542 TTTTGACAGTTGAAAGGAGTTGG - Intergenic
936609012 2:113983311-113983333 TTCTCACAGATTTCATGAGTGGG + Intergenic
937257664 2:120566407-120566429 TTTTGACAGATAGAAGGCATCGG + Intergenic
938844990 2:135199040-135199062 TTCTGACATATTGCAGGACTAGG + Intronic
941010329 2:160292504-160292526 ATCTGAGAGATTTAAGGAGCTGG + Intronic
941451436 2:165665406-165665428 TTCTGTCAGAGTGAAAGAATGGG + Intronic
942131650 2:172885823-172885845 TTCTAACAGATTCAGGGTGTTGG - Intronic
942978674 2:182051307-182051329 TTGTTACAGATTAAAGGAGGTGG + Intronic
945700225 2:213160490-213160512 TACTGACAGATAGAAGTAGAGGG + Intergenic
946053212 2:216880837-216880859 TTCTGAGAACTTGAAGGGGTGGG - Intergenic
946100526 2:217316440-217316462 TGCTGACAGATTGAAGGAGAAGG + Intronic
947030995 2:225794822-225794844 TTATGGCAGATTTAAGGACTTGG + Intergenic
947592316 2:231392860-231392882 TTCTGGAAGGTTGAAGGGGTGGG + Intergenic
948615075 2:239193259-239193281 TTCTCACAGATGGAGGGAGGGGG + Intronic
1169260439 20:4134542-4134564 TTCTGAGAGATTGAGCGAGGTGG + Intronic
1170475698 20:16712439-16712461 TTCTGAAAACTGGAAGGAGTAGG + Intergenic
1172343755 20:34180277-34180299 TTCTGCCAGAGTGAAGCATTTGG + Intergenic
1172786631 20:37473061-37473083 CTCTGGCAGTTTGAAGGGGTGGG - Intergenic
1173018220 20:39245830-39245852 TTCTCACAGATAGAAGGAAGTGG + Intergenic
1173072140 20:39778677-39778699 TATTGACAGAATGAATGAGTGGG + Intergenic
1176877396 21:14146405-14146427 TTCTGATAGATTGAATGTGGAGG - Intronic
1178152398 21:29810448-29810470 TTCTTACAAATTGAAGGTTTTGG - Intronic
1182757425 22:32691134-32691156 TTCTGTGAGACTGCAGGAGTGGG - Intronic
1182959223 22:34456304-34456326 TTCTGAGTGATTGAGGGAGAAGG + Intergenic
1184762486 22:46552405-46552427 ATCTGCCAGATTGCAGGGGTGGG - Intergenic
1184962385 22:47941051-47941073 ATTTGACAGAATGAAGGAATAGG - Intergenic
952126196 3:30303893-30303915 TTCTGACATATTTAAGGCCTTGG - Intergenic
952299271 3:32089599-32089621 ACCTGACAGATTAAAGGTGTTGG - Intergenic
953048247 3:39315177-39315199 TTTTGAGAGGTTGAAGAAGTGGG + Intergenic
953464794 3:43110110-43110132 TTCTGACGTATTGAAGGTTTGGG + Intergenic
955004955 3:54959717-54959739 TTCTGAAAGGTTGAAAGGGTGGG + Intronic
956785231 3:72636956-72636978 TGCTGACAGATTGAAGGTGTGGG - Intergenic
957974996 3:87432215-87432237 TTCTGAGAGTTTGAAAGGGTTGG + Intergenic
957975277 3:87435183-87435205 ATCTGACAGCATGAAGAAGTCGG + Intergenic
961484189 3:127206115-127206137 TTCTGACTGGCTGAAGGTGTCGG + Intergenic
961528097 3:127520664-127520686 CTCTGCCAGGTGGAAGGAGTTGG + Intergenic
962184552 3:133244274-133244296 TTCAGAGAGATGGGAGGAGTAGG - Intronic
963065254 3:141258561-141258583 CTCAGAGAGATTGAAGGAGAGGG + Intronic
963371589 3:144407912-144407934 TTTTGAAAGATTAAAGGAATTGG - Intergenic
963432507 3:145227816-145227838 TTCTCAGAGATTGAAGGAACTGG + Intergenic
964910219 3:161772009-161772031 TTCTGACTAAGTTAAGGAGTGGG - Intergenic
965614466 3:170579057-170579079 TTCTCAAAGATTCAGGGAGTAGG - Intronic
965924791 3:173964638-173964660 TTCATACAGATTTCAGGAGTAGG - Intronic
965971138 3:174558110-174558132 TTCTTAGAACTTGAAGGAGTGGG - Intronic
966772207 3:183514287-183514309 TTGTGGAAGATTGAAGGGGTGGG - Intronic
969404376 4:6979311-6979333 TTCTGACAGATTGTCAGAATGGG + Intronic
969910340 4:10438876-10438898 TTCTAACAAAATGAGGGAGTAGG - Intergenic
972565155 4:40262951-40262973 TTCTGATGGGTTGATGGAGTTGG + Intergenic
974172028 4:58278804-58278826 CTCTGACAGATTGAGAGAGAAGG - Intergenic
974775671 4:66477093-66477115 TTTTGATAGATTGAAGGATAGGG + Intergenic
976036189 4:80824096-80824118 TTCTAATAGGTTGATGGAGTAGG + Intronic
976300679 4:83512863-83512885 CTCTGACATAGTGAAGGAGGAGG + Intronic
977853692 4:101861071-101861093 TTCTGACACATTGCATGTGTGGG + Intronic
978668829 4:111221766-111221788 GTCAGCCAGATTGAAGGACTGGG + Intergenic
984282166 4:177683578-177683600 ATCTTATAGATTGAGGGAGTTGG + Intergenic
985000329 4:185476063-185476085 TTCTGGAAGATTGAAGCAGGGGG - Intergenic
986026237 5:3854064-3854086 TTCTGACAGATAGAGGGAAAAGG + Intergenic
986861053 5:11927150-11927172 CTCTGACAGATACAGGGAGTGGG - Intergenic
990829278 5:59938725-59938747 TTTGGACAGATTGAATGGGTAGG - Intronic
991177518 5:63707090-63707112 TTCAAATAGATTGGAGGAGTGGG - Intergenic
994416502 5:99478273-99478295 TTCTGACAAATTGAAATAGTGGG - Intergenic
994463464 5:100096896-100096918 TTCTGACAAATTGAAATAGTGGG + Intergenic
994613379 5:102074110-102074132 TCCTAACAGATTGAAGAATTGGG + Intergenic
1001428873 5:171644248-171644270 TTCTGAGAGATGGAGGGAGAGGG + Intergenic
1003066674 6:2909619-2909641 TTCTACCAGGTTGAAGGGGTGGG - Intergenic
1004367362 6:15023289-15023311 TTCTGACAAAGTGAAGGAAATGG - Intergenic
1004635689 6:17465555-17465577 TTCTGTCAGGTGGAAGTAGTAGG - Intronic
1006270649 6:32964440-32964462 TTTTGACAGTTTTAAGAAGTGGG + Intronic
1006613544 6:35310136-35310158 CAGTGACAGATTGGAGGAGTTGG - Intronic
1006857111 6:37142021-37142043 TTCTGACAGATCCAAGAAGCTGG - Intergenic
1007643318 6:43361237-43361259 TTCTGACAGATTGAAGGAGTGGG - Intronic
1008338131 6:50331437-50331459 TTCTGACAGATTGTAACAATTGG + Intergenic
1008941763 6:57054344-57054366 TTCTGTCAGATAAAAGGCGTAGG - Exonic
1009277607 6:61703793-61703815 CACTGATAGATTGAAGGAATGGG + Intronic
1013044095 6:106466928-106466950 TTCTGACATGATGGAGGAGTTGG + Intergenic
1013822794 6:114175400-114175422 TTATGACAGATTCAGGGAATTGG + Intronic
1013896179 6:115091274-115091296 TTCTGACAGATTAAAGGTCAGGG - Intergenic
1014282153 6:119453456-119453478 TTATGAGTGAGTGAAGGAGTGGG + Intergenic
1016354155 6:143199926-143199948 TTTTGACAGATGGAAGTGGTGGG + Intronic
1016560185 6:145387902-145387924 TTCTGTCAGGTTGAAGAGGTTGG + Intergenic
1017470194 6:154731800-154731822 TTCAGGAAGATTGAAGGAGGAGG + Intergenic
1018307605 6:162474288-162474310 TCCTGACAGATTCTAGAAGTTGG - Intronic
1018553068 6:165021037-165021059 GTCTGACAGCTTCAAGGAGCTGG - Intergenic
1019515614 7:1438590-1438612 TTCTGGCAGCTTGAGGGACTGGG - Intronic
1021062422 7:16130579-16130601 TTCTGTCAAATTGCAGGATTTGG + Intronic
1021381687 7:19975636-19975658 TTCTTAAAGATAGAAGGAGAAGG - Intergenic
1022900656 7:34806961-34806983 TTCTGTCAGAATTAAGGGGTGGG + Intronic
1024445247 7:49470306-49470328 TTCTGACAGAATGAAGGGAGGGG - Intergenic
1025502040 7:61313617-61313639 TTGTGACAGATTTAAGGCCTAGG - Intergenic
1025516907 7:61659839-61659861 TTGTGACAGATTTAAGGCCTAGG - Intergenic
1025541246 7:62088663-62088685 TTGTGACAGATTTAAGGCCTAGG - Intergenic
1027490546 7:78819254-78819276 TTCTTACAGGTTGAAGGATCAGG + Intronic
1028673302 7:93429780-93429802 TGGTGACAGTGTGAAGGAGTGGG - Intronic
1034346476 7:150388413-150388435 TTCTGACAGATGGCAGGAAAGGG + Exonic
1034364611 7:150535540-150535562 TTCTGAAAAATTGAAGGAAAAGG - Intergenic
1036754133 8:11461266-11461288 ATCTGACAGTTTGGAGGAGATGG + Intronic
1037182811 8:16027668-16027690 TTCTGAGAGATTGAAGCAGCTGG - Intergenic
1039271102 8:35881515-35881537 TTCTGACACATAGTAGGAGGTGG + Intergenic
1039317349 8:36388033-36388055 TTCTGAAAGAATGAAGGAGAAGG - Intergenic
1041148487 8:54905952-54905974 ATCTGACATTTTGAAGGAGAGGG + Intergenic
1041768939 8:61452065-61452087 TTCTGCCAGATTGAAGGCATGGG - Intronic
1041887529 8:62828626-62828648 CTCTAACAGATTCAAAGAGTGGG - Intronic
1042925877 8:73967975-73967997 TGCTTACAGATTGAAGGGTTTGG - Intronic
1044105249 8:88196992-88197014 TTATGAAATATTGGAGGAGTGGG + Intronic
1047576504 8:126161490-126161512 TGCTGACAGATTCGATGAGTAGG + Intergenic
1048173081 8:132127130-132127152 TTCAGCCATATTGAAGGAGTGGG + Exonic
1048732323 8:137456752-137456774 TTCTTAAAGATTAAATGAGTTGG - Intergenic
1049143897 8:140983523-140983545 TTCTTACACATTAAAGAAGTAGG - Intronic
1050457171 9:5845424-5845446 TTCTTAAAGTTTGAGGGAGTGGG + Intergenic
1054785128 9:69203102-69203124 GACTGTCAGAGTGAAGGAGTGGG + Intronic
1054899708 9:70356252-70356274 TTCTGCCAAATTTAAGGAGTGGG + Intergenic
1055418862 9:76114573-76114595 TTCTCACATAGGGAAGGAGTTGG - Intronic
1056446213 9:86668312-86668334 TGGTGACAGCTTGAATGAGTTGG + Intergenic
1058648299 9:107151267-107151289 TTCTCACAGCCTGAAGGAGAAGG + Intergenic
1059367587 9:113798802-113798824 TGCTGACATATAGAAGGAGGTGG - Intergenic
1186190049 X:7059328-7059350 TTCTGACAGATTGGTGGACGCGG - Intronic
1189332036 X:40150175-40150197 TTCTCACAGACTGATGGGGTAGG + Intronic
1192957112 X:76083850-76083872 TTCTGATAGATTCAAGGTTTAGG - Intergenic
1192957378 X:76087174-76087196 TTCTGATAGATTCAAGGTTTAGG + Intergenic
1194124897 X:90004453-90004475 ATCAGACAGATTCAAGGAGAGGG - Intergenic
1198624700 X:138557686-138557708 TTCTAACATATTAAAGTAGTAGG - Intergenic
1199349103 X:146778879-146778901 TGCTGACACATGGATGGAGTTGG + Intergenic
1199379707 X:147155767-147155789 TTCTGTCAGACTGAAGGCCTTGG + Intergenic
1199818351 X:151420438-151420460 TCCTGGCATATTGAAGGAATAGG + Intergenic
1200374689 X:155767500-155767522 ATCTGTCAGATTGGAGGAGAGGG + Intergenic
1200477787 Y:3662062-3662084 ATCAGACAGATTCAAGGAGAGGG - Intergenic