ID: 1007643319

View in Genome Browser
Species Human (GRCh38)
Location 6:43361238-43361260
Sequence ATTCTGACAGATTGAAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007643319_1007643325 14 Left 1007643319 6:43361238-43361260 CCACTCCTTCAATCTGTCAGAAT 0: 1
1: 0
2: 1
3: 22
4: 270
Right 1007643325 6:43361275-43361297 AGGCGATAAGCTGGGCACAATGG No data
1007643319_1007643324 6 Left 1007643319 6:43361238-43361260 CCACTCCTTCAATCTGTCAGAAT 0: 1
1: 0
2: 1
3: 22
4: 270
Right 1007643324 6:43361267-43361289 AAGAAATTAGGCGATAAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 123
1007643319_1007643323 5 Left 1007643319 6:43361238-43361260 CCACTCCTTCAATCTGTCAGAAT 0: 1
1: 0
2: 1
3: 22
4: 270
Right 1007643323 6:43361266-43361288 GAAGAAATTAGGCGATAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 91
1007643319_1007643322 -6 Left 1007643319 6:43361238-43361260 CCACTCCTTCAATCTGTCAGAAT 0: 1
1: 0
2: 1
3: 22
4: 270
Right 1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007643319 Original CRISPR ATTCTGACAGATTGAAGGAG TGG (reversed) Intronic
901333883 1:8431909-8431931 ATGGTGACTGATGGAAGGAGTGG - Intronic
905204643 1:36336319-36336341 ATTATGACAGGTCCAAGGAGTGG - Intergenic
905610115 1:39343229-39343251 ATTCTAAAAAGTTGAAGGAGAGG - Intronic
907805878 1:57819444-57819466 ATTTTTAGAGATTTAAGGAGTGG + Intronic
907845603 1:58203521-58203543 ACTATGACAGAAAGAAGGAGAGG - Intronic
907955933 1:59228262-59228284 ACTCTGATAGAATGAAGAAGTGG - Intergenic
908589200 1:65611337-65611359 ATTCTGAGAGATTGAGTGGGCGG + Intronic
909582025 1:77247410-77247432 ATTATGCCAGCTTGATGGAGGGG - Intergenic
909876563 1:80812435-80812457 AATCTGACAGATTCAAAAAGAGG + Intergenic
910435702 1:87203200-87203222 ATTTTGAGAGAGAGAAGGAGGGG + Intergenic
911741886 1:101395214-101395236 ATTCTAGCAAATTGAAGAAGGGG + Intergenic
916395501 1:164382454-164382476 GGTCTGACAGAGTGAAGGACTGG + Intergenic
916546116 1:165806100-165806122 ATTCAAAAAGATTGAGGGAGAGG + Intronic
916654650 1:166863776-166863798 ATAATGACTGATTGAAGTAGTGG - Intronic
918507255 1:185269615-185269637 AGTCTGACAGAATCAAGTAGTGG + Intronic
919229759 1:194758817-194758839 ATTCAGGAAGATGGAAGGAGGGG - Intergenic
919676849 1:200392505-200392527 ATTCTGACAAATTGAAAGGCAGG - Intergenic
919937599 1:202264892-202264914 CTCCTGACAGATGGAAGGAAAGG + Intronic
921529460 1:216263231-216263253 ATTCCAAAAAATTGAAGGAGAGG + Intronic
923360127 1:233203060-233203082 ATGCTGCCAGGTTGAAGGGGAGG - Intronic
923443170 1:234040499-234040521 ATTCTGAATGATAGAAGCAGGGG - Intronic
923784514 1:237054336-237054358 TTCCTGACAGATGGAGGGAGGGG - Intronic
924059224 1:240154467-240154489 ATCCTGACACATTGAAGAAATGG + Intronic
924086008 1:240452326-240452348 TTTCTGACTAATTAAAGGAGTGG - Intronic
1062951085 10:1504057-1504079 ATACTGGCAGAGTGAAGGATTGG - Intronic
1062994519 10:1853411-1853433 ACACTGGCAGACTGAAGGAGTGG - Intergenic
1063269222 10:4487874-4487896 ATTGTGACAGACAGCAGGAGAGG - Intergenic
1065251753 10:23822617-23822639 AATCTGACAAATGGAACGAGAGG - Intronic
1068107485 10:52637308-52637330 GTTCAGAGAGATTGAAGCAGGGG - Intergenic
1068310754 10:55271639-55271661 GATCAGACAGATTGAAGCAGTGG + Intronic
1068938950 10:62662232-62662254 AGTCTGACTGGTTGCAGGAGGGG + Intronic
1070574195 10:77665176-77665198 ATTTTGACAGATTGAAACAAGGG + Intergenic
1071534624 10:86417740-86417762 ATTCCTAAAGAATGAAGGAGTGG + Intergenic
1071870155 10:89785225-89785247 AGTCTGATTGATTGAGGGAGGGG + Intergenic
1073501736 10:103945432-103945454 TTTCTGACAGCTAGAAGTAGAGG + Intergenic
1075464750 10:122642983-122643005 GTTCTGACAGAAGGAAGGTGAGG + Intronic
1075509323 10:123056988-123057010 GTTCTGAAAGAGTGAATGAGTGG - Exonic
1075675138 10:124291017-124291039 ATTCTGACAGTAAGAATGAGAGG + Intergenic
1075719754 10:124577786-124577808 ATGCTGCCAGAGTGGAGGAGGGG - Intronic
1075839939 10:125492962-125492984 ATTCTGACAGATACCAGGAGGGG + Intergenic
1076472825 10:130731010-130731032 ATTCTAAAAGAATGAAGGAAGGG + Intergenic
1076474150 10:130740730-130740752 AATCTGACAGATGGTGGGAGGGG + Intergenic
1079150402 11:17893996-17894018 ATTTTGACAGAGTGGGGGAGAGG - Intronic
1081294087 11:41364106-41364128 ATTCTGTCAGGTTGCATGAGAGG + Intronic
1082839808 11:57679760-57679782 ATTCTGCTTGATTTAAGGAGAGG - Intronic
1084595344 11:70113469-70113491 AGCCTGACAGAATGGAGGAGTGG - Intronic
1085212775 11:74796652-74796674 ACTCTGAAAGACTGAAGGTGGGG + Intronic
1086436333 11:86784598-86784620 ACTCTGGAAAATTGAAGGAGTGG + Intergenic
1088946608 11:114519626-114519648 AGTTTGACAGGTGGAAGGAGGGG + Intergenic
1089192639 11:116664780-116664802 TGCCTGGCAGATTGAAGGAGGGG - Intergenic
1089791695 11:120949843-120949865 ATACTGACAGATGGAAGAACTGG - Intronic
1090061844 11:123470757-123470779 ATTTTGACAGATAAAAGGATGGG + Intergenic
1090363483 11:126188655-126188677 TTTCAGAGAGATTGCAGGAGAGG - Intergenic
1091203415 11:133800388-133800410 TTGCTGATAGATTGAAAGAGGGG + Intergenic
1091842110 12:3628638-3628660 ATTCTTACAGGATGCAGGAGTGG - Intronic
1093364504 12:18275786-18275808 TTTCTGACAGATTTGAGAAGAGG - Intronic
1094241727 12:28234631-28234653 ATTCTCACAGTGTGAAGGAAGGG - Intronic
1094500963 12:31020505-31020527 ATTCTAACAGGAGGAAGGAGAGG + Intergenic
1096023122 12:48338585-48338607 ATTCTGACAGATTCAGGCTGTGG - Exonic
1097646275 12:62238179-62238201 CATCTGGCAGATGGAAGGAGGGG + Intronic
1101594360 12:106150886-106150908 GTACTGACAGAGTGAATGAGAGG + Intergenic
1105539358 13:21301649-21301671 ATTTTAACAGGTTGAAAGAGAGG - Intergenic
1107391345 13:39967820-39967842 ATTCTGACAGTTGCATGGAGAGG - Intergenic
1108277729 13:48827901-48827923 CTACTGACAGAATGAAGGAAGGG + Intergenic
1108426456 13:50306663-50306685 ATTCTGAAAAATTGAAGAGGAGG - Intronic
1109809050 13:67485166-67485188 ATTCAAAAAGATTGAAGGCGAGG - Intergenic
1110498116 13:76193018-76193040 ATTCTGACAAATGAAAGTAGAGG - Intergenic
1110555661 13:76856504-76856526 AGTCTGATTGATTGCAGGAGGGG + Intergenic
1113327945 13:109301032-109301054 ATTCTCACATATGTAAGGAGAGG - Intergenic
1115092123 14:29590453-29590475 ATTCTGTCAGAGTGAATGAGTGG - Intronic
1117530263 14:56654109-56654131 ATTCTGGAGGGTTGAAGGAGAGG - Intronic
1119813435 14:77543769-77543791 ATTCTGGCTGATTGAATCAGTGG - Intronic
1120502219 14:85310836-85310858 ATCCTGACACGTTGAAGGTGGGG - Intergenic
1122810870 14:104287292-104287314 GTTCTGCCAGACTGAAGGGGTGG + Intergenic
1123911267 15:24969923-24969945 GTTGTGACAGATTGAATGACAGG + Intronic
1124697343 15:31875528-31875550 ATTCTTAAAAAATGAAGGAGAGG - Intergenic
1125251116 15:37705739-37705761 AATATGACAGATGGAAGCAGTGG + Intergenic
1129153415 15:73703163-73703185 GTTCTGGGAGATTGAAGGTGGGG - Intronic
1138807522 16:60108194-60108216 AATCTGACTGATTGCAGGAGGGG + Intergenic
1141213065 16:81999103-81999125 ATTCTGTCACTGTGAAGGAGGGG - Exonic
1141289626 16:82705846-82705868 ATTCTGACTGCATGAAGAAGGGG + Intronic
1142246130 16:88970891-88970913 GGGGTGACAGATTGAAGGAGAGG + Intronic
1142414339 16:89933398-89933420 ATTCAGAAAGAATGAGGGAGAGG + Intronic
1144245715 17:13362278-13362300 ATTCTACCAGATTTAAGGAATGG + Intergenic
1145275339 17:21425828-21425850 TTTCAGACACATTGGAGGAGAGG + Intergenic
1145313194 17:21711722-21711744 TTTCAGACACATTGGAGGAGAGG + Intergenic
1146114842 17:30125856-30125878 ATTCTGACAATTTGAAAAAGAGG - Intronic
1146486724 17:33249108-33249130 TTTCTGACAGACTGGAGGTGGGG + Intronic
1148836346 17:50467803-50467825 ATTCTTACATATAAAAGGAGTGG - Intronic
1149892079 17:60399061-60399083 ATTAGTCCAGATTGAAGGAGTGG + Intronic
1149953073 17:61012846-61012868 AATTTGACAGATAAAAGGAGTGG - Intronic
1150149508 17:62797772-62797794 AGTCTGACAGATGGCAGGACTGG + Intronic
1150491004 17:65574229-65574251 AATATGACAGATTTAAGGTGAGG + Intronic
1152046507 17:77940121-77940143 TTTCTCACAGTTCGAAGGAGAGG - Intergenic
1153261709 18:3230628-3230650 AGTCTGATTGATTGCAGGAGAGG - Intergenic
1155196222 18:23477356-23477378 ATTCTTAGAAATTGAAGGAAGGG + Intronic
1156539382 18:37894484-37894506 ATTTTGCCAGATTGAGGAAGAGG - Intergenic
1157353659 18:46914251-46914273 ATCCTGATGGATTGAAGGAAAGG - Intronic
1157753260 18:50196185-50196207 ATTCTGATATAATGAAGGATGGG + Intergenic
1158879328 18:61761573-61761595 CATCTGACAGATGGAAGAAGAGG + Intergenic
1159441207 18:68483202-68483224 ATTCCCACATGTTGAAGGAGGGG - Intergenic
1160390374 18:78526909-78526931 ATTCTCACAGCTCCAAGGAGAGG - Intergenic
1161385550 19:3990370-3990392 ATTCTGACCAATAGCAGGAGTGG - Intergenic
1161387108 19:4001060-4001082 ATTCTGACAGTTTCTAGGACAGG + Intergenic
1163607516 19:18283024-18283046 AATCTGCCAGAATGATGGAGTGG + Intergenic
1164100525 19:22050937-22050959 ATTCTGCCAGTGTGAAGGAAGGG - Intergenic
1164240628 19:23385089-23385111 GTTCGGACAGGTTGGAGGAGTGG - Intronic
1166147062 19:40845175-40845197 TTTTTGACTGATTGAGGGAGTGG + Intronic
1166151220 19:40877072-40877094 TTTTTGACTGATTGAGGGAGTGG + Intronic
1166179083 19:41094533-41094555 TTTTTGACTGATTGAGGGAGTGG - Intronic
1167854611 19:52227472-52227494 ATTCTAACTGATGGAGGGAGGGG + Exonic
1167962529 19:53118155-53118177 ATTTTGTTAGATTGAAGTAGAGG - Intronic
1168274380 19:55269035-55269057 TTGCTTACAGATTGAATGAGAGG - Intronic
1168485433 19:56758502-56758524 AGTCGGAGAGAATGAAGGAGCGG + Intergenic
925261218 2:2530163-2530185 ATTCTGTCAGCCTGAAGCAGAGG - Intergenic
925538341 2:4939898-4939920 ATTCTGACAACTTGAAGGTCAGG - Intergenic
927761262 2:25757076-25757098 CTTCTAATATATTGAAGGAGAGG + Intronic
928087524 2:28355312-28355334 ATGATGGCAGCTTGAAGGAGGGG - Intergenic
929139650 2:38655758-38655780 AGACTGACAGTTGGAAGGAGAGG - Intergenic
930695687 2:54409552-54409574 ACTCTGACACACTGAAGGAAAGG - Intergenic
930803722 2:55469317-55469339 ATCCCCACATATTGAAGGAGGGG + Intergenic
931578904 2:63752210-63752232 ATTATGACTGATTGAGGCAGTGG - Intronic
932073119 2:68640815-68640837 ATTCTGAAAAATTGAAGCAACGG + Intergenic
935654570 2:105410779-105410801 ATGCTGCCAGATTTAAGGTGAGG + Intronic
938619639 2:133036278-133036300 ATTCTGAAAGATAGAAGAGGAGG + Intronic
938771988 2:134508644-134508666 ATAGTGACGGATTGAGGGAGGGG - Intronic
938842851 2:135179698-135179720 TTTCTTACTGATTGAAGGTGGGG - Intronic
939609263 2:144290291-144290313 ATTATGACAGATTGAATATGGGG - Intronic
941257106 2:163246019-163246041 ATTCTGACAATGTGAAGAAGAGG - Intergenic
941451435 2:165665405-165665427 ATTCTGTCAGAGTGAAAGAATGG + Intronic
942163378 2:173216075-173216097 ATACTGAGAGAATGAGGGAGAGG - Intronic
942385801 2:175441553-175441575 CTTTTGACAGATTGAAGGTTCGG + Intergenic
943577589 2:189649016-189649038 ACTCTGACAGTTTGAAAAAGAGG + Intergenic
944385649 2:199161073-199161095 ACTCAGACAGATTAAAGGACAGG + Intergenic
944972509 2:205010127-205010149 ATACTGAGAGAGAGAAGGAGTGG + Intronic
945673123 2:212826019-212826041 ATTCTGAGATATTGAAGGTTAGG - Intergenic
945700224 2:213160489-213160511 GTACTGACAGATAGAAGTAGAGG + Intergenic
945737115 2:213614415-213614437 ACTCTGAGAGATAGAAAGAGTGG + Intronic
946961207 2:224987662-224987684 AGTCTGACCAAGTGAAGGAGAGG + Intronic
947592315 2:231392859-231392881 ATTCTGGAAGGTTGAAGGGGTGG + Intergenic
948615074 2:239193258-239193280 TTTCTCACAGATGGAGGGAGGGG + Intronic
1171983406 20:31642881-31642903 ATTCTAACAGAATTAGGGAGGGG - Intronic
1172161788 20:32873834-32873856 ATTCAGACATCTAGAAGGAGAGG - Intronic
1172935741 20:38618869-38618891 AGCCTGACAGATTCAAGGGGAGG + Intronic
1173072139 20:39778676-39778698 ATATTGACAGAATGAATGAGTGG + Intergenic
1173488638 20:43459553-43459575 TCTCTAACAGATTGTAGGAGAGG + Intronic
1177126367 21:17198154-17198176 CTTCTGACCAATTTAAGGAGAGG - Intergenic
1177725487 21:24961472-24961494 ATTCTTGCAGATTGGATGAGAGG + Intergenic
1179224875 21:39444735-39444757 GTGCTGACAGACTGAAGGTGAGG + Intronic
949270831 3:2214533-2214555 AGTTTCTCAGATTGAAGGAGAGG + Intronic
950313230 3:11977263-11977285 ATTCTGCCTGATTGCAGGGGTGG - Intergenic
951159112 3:19394671-19394693 ATTCAGACAAATTGAAGTAAAGG - Intronic
953048246 3:39315176-39315198 ATTTTGAGAGGTTGAAGAAGTGG + Intergenic
953222273 3:40983214-40983236 ATGCTGACAACGTGAAGGAGAGG + Intergenic
955725049 3:61924206-61924228 ATTCTGGCAGACAGAAGGACAGG - Intronic
956013369 3:64855228-64855250 ACACTGATAGAATGAAGGAGTGG + Intergenic
956013643 3:64858323-64858345 ACACTGATAGAATGAAGGAGTGG - Intergenic
956785232 3:72636957-72636979 TTGCTGACAGATTGAAGGTGTGG - Intergenic
957276968 3:78102837-78102859 ATTCTGATAGCTAGGAGGAGAGG + Intergenic
957549466 3:81685283-81685305 TTTCTCACGGACTGAAGGAGAGG - Intronic
959194268 3:103158450-103158472 AGTCTGATTGATTGAGGGAGGGG + Intergenic
962105606 3:132385564-132385586 ATTTTTAAAGATTGAAGGAGTGG - Intergenic
962171245 3:133103666-133103688 ATTCTGACAGAAACATGGAGGGG - Intronic
962971292 3:140404250-140404272 ATTCTTACTGAATGGAGGAGTGG + Intronic
963065253 3:141258560-141258582 ACTCAGAGAGATTGAAGGAGAGG + Intronic
963615241 3:147528495-147528517 TTTCTGAAAGATTTTAGGAGGGG + Intergenic
964994458 3:162858352-162858374 ATTCCAAAAGATTGAAGAAGAGG + Intergenic
965971139 3:174558111-174558133 ATTCTTAGAACTTGAAGGAGTGG - Intronic
966477434 3:180366587-180366609 ATCCTCACATGTTGAAGGAGGGG - Intergenic
966772208 3:183514288-183514310 ATTGTGGAAGATTGAAGGGGTGG - Intronic
968537440 4:1143261-1143283 ATTCTGACAGAATGAAAATGGGG - Intergenic
970509912 4:16771667-16771689 TTGCTGACAGATTGGAGGTGTGG - Intronic
971335145 4:25716344-25716366 ATTCTGACACATTCAAGTATTGG + Intergenic
971876691 4:32317962-32317984 ATTCTGACAGTGTGAAGAAGAGG + Intergenic
972274583 4:37545223-37545245 ATTCTCACAGAAACAAGGAGGGG + Intronic
972346100 4:38193589-38193611 CTTCTGAGAAGTTGAAGGAGGGG - Intergenic
973094669 4:46181586-46181608 ATTCCAAAAGATTGAAGAAGAGG + Intergenic
974775670 4:66477092-66477114 ATTTTGATAGATTGAAGGATAGG + Intergenic
977299256 4:95249317-95249339 AGTCTTACTGACTGAAGGAGGGG - Intronic
978348894 4:107800561-107800583 TTTCAGTAAGATTGAAGGAGAGG - Intergenic
978542377 4:109831870-109831892 ATTCTGCCAGAAGCAAGGAGAGG + Intronic
978668828 4:111221765-111221787 AGTCAGCCAGATTGAAGGACTGG + Intergenic
978965105 4:114731190-114731212 ATTCTTACAGTTAGAAGGGGTGG - Intergenic
982301029 4:153879717-153879739 ATTCTGCCATATTGAAGGCTAGG - Intergenic
984197311 4:176674207-176674229 ATTGTGAGAGCTTGGAGGAGAGG - Intergenic
984232803 4:177119801-177119823 ATCCTCAGAGACTGAAGGAGAGG + Intergenic
985000330 4:185476064-185476086 ATTCTGGAAGATTGAAGCAGGGG - Intergenic
986367605 5:7049011-7049033 CTTCTGACATATTTAAGGAAAGG - Intergenic
986636360 5:9825732-9825754 ATTTTTACAGATTGAATGTGTGG - Intergenic
986861054 5:11927151-11927173 ACTCTGACAGATACAGGGAGTGG - Intergenic
987858508 5:23452729-23452751 ATTCTGCCAGTTTGAAAGATTGG - Intergenic
988185347 5:27853942-27853964 ATTCTAACCCAGTGAAGGAGAGG - Intergenic
989439934 5:41458384-41458406 ATTCTGAGAGATAGAAGGGATGG + Intronic
990394675 5:55364954-55364976 ATACTGTCAGAGTGAAAGAGGGG + Intronic
990671378 5:58133949-58133971 AATATGACAGATTGAATTAGAGG + Intergenic
991131468 5:63126992-63127014 ATTGTGACAGAAAGAAGTAGTGG - Intergenic
992374596 5:76175888-76175910 ATTCTGACAGAGTGCAGTGGGGG - Intronic
992758338 5:79930120-79930142 TTTCTGATGGATTGAATGAGGGG + Intergenic
994416503 5:99478274-99478296 ATTCTGACAAATTGAAATAGTGG - Intergenic
994463463 5:100096895-100096917 ATTCTGACAAATTGAAATAGTGG + Intergenic
995584465 5:113633304-113633326 ATTCTGACAGGATGAAGAATTGG + Intergenic
996448542 5:123588425-123588447 AGGCTGACACATTAAAGGAGAGG + Exonic
996489466 5:124076587-124076609 ATCCTAAAAAATTGAAGGAGAGG - Intergenic
996496151 5:124158967-124158989 ATTCTGATAGAGTGAAGGCAGGG - Intergenic
1000183104 5:158831823-158831845 CTTCTGACACATTGAATGACTGG - Intronic
1000594937 5:163204098-163204120 ATTTTGACAGATTGAGGGGGAGG + Intergenic
1001267302 5:170283181-170283203 ATTCAAACACATTGGAGGAGGGG + Intronic
1001428872 5:171644247-171644269 ATTCTGAGAGATGGAGGGAGAGG + Intergenic
1002661462 5:180793328-180793350 AATCTGACAGGTAGAAAGAGGGG - Intronic
1003066675 6:2909620-2909642 ATTCTACCAGGTTGAAGGGGTGG - Intergenic
1003324320 6:5081314-5081336 ATTGTGCCAGAGTGGAGGAGTGG + Intergenic
1004790597 6:19022008-19022030 AGTTTGAGAGATGGAAGGAGGGG + Intergenic
1004999829 6:21229707-21229729 ATTTTGAGAGATGGAAGGAGGGG - Intronic
1005972201 6:30770131-30770153 TTGCTCACAGATTGAAGGAGGGG - Intergenic
1006270648 6:32964439-32964461 ATTTTGACAGTTTTAAGAAGTGG + Intronic
1006835981 6:36999096-36999118 ATTCTGGCTGCTTGGAGGAGGGG + Intergenic
1007643319 6:43361238-43361260 ATTCTGACAGATTGAAGGAGTGG - Intronic
1009277606 6:61703792-61703814 ACACTGATAGATTGAAGGAATGG + Intronic
1010833478 6:80558075-80558097 ATTCTGACAGATTAAACAAAAGG + Intergenic
1012229779 6:96747350-96747372 ATTCTGTCCGATTGAAAGAGTGG + Intergenic
1013040427 6:106427454-106427476 ATACTGACAGAATGAAGGTGGGG - Intergenic
1013896180 6:115091275-115091297 TTTCTGACAGATTAAAGGTCAGG - Intergenic
1014386590 6:120810426-120810448 ATTCCCAAAAATTGAAGGAGAGG + Intergenic
1015111482 6:129596755-129596777 AACCAGACAGAATGAAGGAGGGG + Intronic
1015455975 6:133426775-133426797 ATTCAGACAGATGGGAAGAGAGG - Intronic
1016301492 6:142636519-142636541 ACTCTGCCAGTTTGAAGGAAAGG - Intergenic
1017212204 6:151869267-151869289 AATCGAACAGAGTGAAGGAGAGG + Intronic
1017245262 6:152217550-152217572 ATTCTGACAGCCAGGAGGAGGGG + Intronic
1017560216 6:155619405-155619427 ATTCTGAGATATTGCTGGAGAGG - Intergenic
1017757119 6:157539072-157539094 GTTGGGACAGATTGAAGGAGGGG + Intronic
1020611097 7:10399372-10399394 ATTCTGAGAGATTTAATGAAGGG + Intergenic
1021007066 7:15410978-15411000 ATTGTGACAGATTTAAGAATTGG + Intronic
1021226850 7:18037778-18037800 AGTCTGATTGATTGCAGGAGGGG - Intergenic
1022852176 7:34275193-34275215 ATTCTGCCAGAGTGATGCAGGGG + Intergenic
1024445248 7:49470307-49470329 CTTCTGACAGAATGAAGGGAGGG - Intergenic
1024469952 7:49757662-49757684 ATACAGAAAGATTGAAGGAATGG + Intergenic
1024498632 7:50075858-50075880 ATTCTGAAAAATAGAAGAAGAGG + Intronic
1033016826 7:137680029-137680051 ATTCTGTCACATTGAGGGTGAGG - Intronic
1033556867 7:142495764-142495786 ATACTGTGAGATTGAAGGGGAGG + Intergenic
1033638320 7:143234569-143234591 ATTTTGAAAAATTGAAGAAGAGG - Intergenic
1034346475 7:150388412-150388434 TTTCTGACAGATGGCAGGAAAGG + Exonic
1035306057 7:157932635-157932657 ATTCTGACAGTTTGAGAGTGGGG + Intronic
1037537945 8:19844573-19844595 CTTTTGACAGATGGAAGAAGAGG - Intronic
1037995495 8:23349356-23349378 ATTCTGATAGATAGAAAGAAGGG - Intronic
1038890184 8:31712906-31712928 AGACAGACAGATTGAAGAAGGGG - Intronic
1041148486 8:54905951-54905973 TATCTGACATTTTGAAGGAGAGG + Intergenic
1041403753 8:57473475-57473497 CTTCTGACACACTGAAGTAGGGG + Intergenic
1041768940 8:61452066-61452088 ATTCTGCCAGATTGAAGGCATGG - Intronic
1042613032 8:70618653-70618675 ATTTTAACAGAATGAATGAGTGG + Intronic
1043035783 8:75197123-75197145 ATTCTGAAAGGTTGAAGGAGGGG + Intergenic
1043097954 8:75999543-75999565 TTTTTGACAGATGGAAGGGGGGG + Intergenic
1043327933 8:79075948-79075970 TTTGTGACAAATTGAAGGAAAGG + Intergenic
1043646462 8:82526748-82526770 ATTTTGAAGGATTGAAGGATGGG + Intergenic
1044757417 8:95479177-95479199 ATTCTGAGATATTGGAGAAGGGG + Intergenic
1045984713 8:108236668-108236690 ATATTAACAGATTGGAGGAGGGG - Intronic
1046819381 8:118619501-118619523 TTTCTGACAGATTTGAGGATGGG - Intronic
1047452291 8:124975672-124975694 ATTCTAACAGCTTTATGGAGAGG + Exonic
1048173080 8:132127129-132127151 TTTCAGCCATATTGAAGGAGTGG + Exonic
1049407572 8:142458441-142458463 AAGCTGTGAGATTGAAGGAGGGG + Intronic
1049913067 9:288664-288686 ACTCTAACAGCTTTAAGGAGAGG + Intronic
1053672306 9:40379058-40379080 ATTCTAAAAAATTGAAGAAGAGG + Intergenic
1054512317 9:65997251-65997273 ATTCTAAAAAATTGAAGAAGAGG - Intergenic
1054724446 9:68636180-68636202 ATCATGATAGATAGAAGGAGCGG - Intergenic
1054802827 9:69368682-69368704 ATTCCAAAAAATTGAAGGAGAGG - Intronic
1054899707 9:70356251-70356273 TTTCTGCCAAATTTAAGGAGTGG + Intergenic
1055173386 9:73288152-73288174 ATTATGAGAGATTTGAGGAGAGG + Intergenic
1055610051 9:78013163-78013185 TTTGTGTCAGATGGAAGGAGAGG - Intronic
1056312656 9:85356370-85356392 ATTCTGACAGATAGAGAAAGAGG - Intergenic
1060347142 9:122827370-122827392 ATTCTGACAGTTTAAAAGAAGGG + Intronic
1187668965 X:21649715-21649737 AGTGTGGGAGATTGAAGGAGAGG + Intronic
1187683528 X:21792780-21792802 ACTCTGGCAGAGAGAAGGAGGGG - Intergenic
1187766095 X:22643862-22643884 ATGCTGGCAGATGGAAGGCGGGG + Intergenic
1188008928 X:25038170-25038192 ATGCTGAGAGATTGAAGGACTGG + Intergenic
1188849400 X:35113362-35113384 ATTCTGAAAGAGTTAAGCAGAGG + Intergenic
1189022354 X:37354274-37354296 ATTCAGACAGGTTGGTGGAGAGG + Intronic
1191148473 X:57194061-57194083 ATTCTGAAATATGGAAGAAGAGG - Intergenic
1191750211 X:64534463-64534485 CTTGTGACAGATTGGAGGGGAGG - Intergenic
1193041937 X:77013340-77013362 ATGCTGCAAGATTGAAGGTGGGG - Intergenic
1193889082 X:87020774-87020796 ATTCTGAAAAATTGAGGAAGAGG + Intergenic
1193915755 X:87361302-87361324 ATTCTGAAAAATAGAAGGGGAGG + Intergenic
1194124898 X:90004454-90004476 AATCAGACAGATTCAAGGAGAGG - Intergenic
1194349729 X:92811175-92811197 ATTGTAAGAGATTTAAGGAGTGG + Intergenic
1194435427 X:93863544-93863566 ATTCTGACTGGTGAAAGGAGAGG - Intergenic
1194770781 X:97902116-97902138 TTTCTGACAGATTGAATGTAGGG + Intergenic
1194881383 X:99255748-99255770 ATTCTGAAAGATAGAAGAGGAGG - Intergenic
1195256761 X:103098254-103098276 ATCTTCACAGAGTGAAGGAGAGG + Intergenic
1197306937 X:124854034-124854056 ATTCAGTGAGAGTGAAGGAGGGG + Intronic
1197749757 X:129956622-129956644 ATAATGAGAGATGGAAGGAGTGG + Intergenic
1198612304 X:138415588-138415610 ATTCTGAAAAATAGAGGGAGAGG + Intergenic
1199413777 X:147556200-147556222 ATTTTGACAGCTTGAAAGAATGG - Intergenic
1200374688 X:155767499-155767521 CATCTGTCAGATTGGAGGAGAGG + Intergenic
1200477788 Y:3662063-3662085 AATCAGACAGATTCAAGGAGAGG - Intergenic
1200658052 Y:5927778-5927800 ATTGTAAGAGATTTAAGGAGTGG + Intergenic
1201334823 Y:12869485-12869507 ATCCAGCCACATTGAAGGAGAGG + Intergenic