ID: 1007643322

View in Genome Browser
Species Human (GRCh38)
Location 6:43361255-43361277
Sequence CAGAATAAGGAGAAGAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007643317_1007643322 22 Left 1007643317 6:43361210-43361232 CCTAAAGAAAATCAGAGGGAAAA 0: 1
1: 0
2: 9
3: 109
4: 948
Right 1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG No data
1007643319_1007643322 -6 Left 1007643319 6:43361238-43361260 CCACTCCTTCAATCTGTCAGAAT 0: 1
1: 0
2: 1
3: 22
4: 270
Right 1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG No data
1007643318_1007643322 -5 Left 1007643318 6:43361237-43361259 CCCACTCCTTCAATCTGTCAGAA 0: 1
1: 0
2: 2
3: 17
4: 200
Right 1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG No data
1007643316_1007643322 23 Left 1007643316 6:43361209-43361231 CCCTAAAGAAAATCAGAGGGAAA 0: 1
1: 0
2: 4
3: 63
4: 676
Right 1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007643322 Original CRISPR CAGAATAAGGAGAAGAAATT AGG Intronic
No off target data available for this crispr