ID: 1007651769

View in Genome Browser
Species Human (GRCh38)
Location 6:43427072-43427094
Sequence ATGCAGCCCTAGAATAATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007651759_1007651769 30 Left 1007651759 6:43427019-43427041 CCCCCCCAAAAAAAAGTTGAGGC No data
Right 1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG No data
1007651763_1007651769 26 Left 1007651763 6:43427023-43427045 CCCAAAAAAAAGTTGAGGCTCAA No data
Right 1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG No data
1007651761_1007651769 28 Left 1007651761 6:43427021-43427043 CCCCCAAAAAAAAGTTGAGGCTC No data
Right 1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG No data
1007651760_1007651769 29 Left 1007651760 6:43427020-43427042 CCCCCCAAAAAAAAGTTGAGGCT No data
Right 1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG No data
1007651764_1007651769 25 Left 1007651764 6:43427024-43427046 CCAAAAAAAAGTTGAGGCTCAAA No data
Right 1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG No data
1007651762_1007651769 27 Left 1007651762 6:43427022-43427044 CCCCAAAAAAAAGTTGAGGCTCA No data
Right 1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007651769 Original CRISPR ATGCAGCCCTAGAATAATAA GGG Intergenic
No off target data available for this crispr