ID: 1007652470

View in Genome Browser
Species Human (GRCh38)
Location 6:43432127-43432149
Sequence CTGGACTCCTGGGGACAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007652470_1007652479 6 Left 1007652470 6:43432127-43432149 CCCCCTTGTCCCCAGGAGTCCAG 0: 1
1: 0
2: 3
3: 34
4: 375
Right 1007652479 6:43432156-43432178 TCCTACCCTGCAGTCCTGGATGG 0: 1
1: 0
2: 0
3: 14
4: 182
1007652470_1007652478 2 Left 1007652470 6:43432127-43432149 CCCCCTTGTCCCCAGGAGTCCAG 0: 1
1: 0
2: 3
3: 34
4: 375
Right 1007652478 6:43432152-43432174 TACATCCTACCCTGCAGTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007652470 Original CRISPR CTGGACTCCTGGGGACAAGG GGG (reversed) Exonic
900208325 1:1440973-1440995 CTGGAATGCAGAGGACAAGGGGG + Exonic
900543059 1:3213669-3213691 CTGGAATCCTGGGGAAATGCTGG - Intronic
900646661 1:3711984-3712006 CGGGATTCCTGGGGAGAATGAGG + Intronic
900652311 1:3735710-3735732 TGGCACTCCTGGGGCCAAGGGGG + Exonic
901183473 1:7357342-7357364 CTGGGCTCCTGGTGAGGAGGGGG + Intronic
901674026 1:10872475-10872497 CTGGACTCCTGGCCACCTGGAGG - Intergenic
901814744 1:11787722-11787744 CTGGAGGCCTGGGGAGATGGGGG + Exonic
902380717 1:16051054-16051076 GTGCACACCTGGGGACCAGGGGG - Intronic
902381617 1:16055505-16055527 CTGGGCTCCTGGACACCAGGTGG + Exonic
903778938 1:25809626-25809648 CCGGGCTCCTGGGGAGAAGGTGG + Intronic
903809001 1:26024230-26024252 CTGGCCTGCTGGGGACACAGAGG - Intronic
903844729 1:26272077-26272099 CAGGAATCCTTGGGACATGGTGG + Intronic
903876945 1:26481464-26481486 CTGTAGTCCTGGCTACAAGGGGG - Intergenic
905295012 1:36948776-36948798 CTGGAGGGCTGGAGACAAGGAGG - Intronic
906023252 1:42650285-42650307 TTGAACTCCTGGGTACAAGCTGG - Intronic
906716466 1:47973341-47973363 ATGGACTACTGGGGAGAAAGGGG + Intronic
906766045 1:48435218-48435240 CTGGACTCCCTGGGTCAAGTGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909501998 1:76345092-76345114 CTGGCCTCATGGTGACAAAGAGG - Intronic
910558368 1:88562492-88562514 CTTGACACCTGGGGATTAGGGGG + Intergenic
911880657 1:103234926-103234948 TTGCACTCCTGGAGGCAAGGAGG - Intergenic
915459449 1:156061118-156061140 CTGGAGACCTGGGGCCCAGGTGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917535179 1:175869321-175869343 CTGAACTTCTGGGGAGAAGCAGG - Intergenic
919832686 1:201552979-201553001 CAGGCCTCCAGGGGACGAGGGGG + Intergenic
919861229 1:201740467-201740489 CGGGGGTCCTGGGGACCAGGCGG + Intronic
920002086 1:202807484-202807506 CTGGAGGCCCGGGGACCAGGCGG + Intronic
920081812 1:203380181-203380203 CTGGACTCCAGGGGCCCAGGAGG - Intergenic
920123165 1:203673817-203673839 GTGGAGTCCTCAGGACAAGGGGG - Intronic
920510947 1:206551637-206551659 CTGAAGTCCTGGCCACAAGGAGG + Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
922586007 1:226735961-226735983 GTGCCCTCCTGGGGACAGGGTGG - Exonic
923196506 1:231673408-231673430 TTGAACTCCTGGGCTCAAGGAGG + Intronic
923779330 1:237008295-237008317 CTGGGCTGCTGAGGACATGGTGG - Intergenic
924011727 1:239672353-239672375 CTTGTCTCCTGCTGACAAGGAGG - Intronic
1062789474 10:292694-292716 CTGGCCTCCTGGGAACAGGTGGG + Intronic
1067210831 10:44259413-44259435 CAGGGCTCCTGGGGCCCAGGGGG + Intergenic
1067559428 10:47294621-47294643 CTGGACTTCCTGGGTCAAGGGGG - Intergenic
1067561446 10:47307563-47307585 GGGGACTGCTGGGGACAAGATGG - Intronic
1069119796 10:64555633-64555655 CTGAACTTCGGGGGACTAGGTGG - Intergenic
1069717372 10:70529796-70529818 CTGGGCTCCAGGGGACAGGGAGG - Intronic
1069794067 10:71041253-71041275 CTGGCCTCCTGGGGACCGAGCGG + Intergenic
1069809049 10:71145009-71145031 CAGGACTCCTGGGGAAGAGTTGG - Intergenic
1069871552 10:71536144-71536166 ATGGTGTCATGGGGACAAGGAGG + Intronic
1069906722 10:71736399-71736421 CAGGGCTGCTGGGGACAGGGAGG - Intronic
1070000575 10:72373662-72373684 CAGGACTTCTAGGGAAAAGGGGG + Intronic
1070597322 10:77841671-77841693 CTGGATTACAGGGGACAAGGCGG - Intronic
1073288454 10:102401977-102401999 CGGGAGCCCTGGGGCCAAGGAGG - Intronic
1074142740 10:110689280-110689302 CTGGAGGCCTGGGGACACAGGGG + Intronic
1074371914 10:112907169-112907191 CTGGCCTCCCGGGGCTAAGGAGG + Intergenic
1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG + Intergenic
1075567320 10:123514063-123514085 CTGGAGTCCTGGGGAAGGGGAGG + Intergenic
1076053686 10:127354364-127354386 CTTGGCTCCTGGGCCCAAGGGGG - Intronic
1076468264 10:130700717-130700739 CAGGGCTCTAGGGGACAAGGTGG + Intergenic
1077094279 11:792720-792742 CTGGGCGGCTGGGGACAAAGAGG + Exonic
1077866240 11:6223876-6223898 CTGGGCTACTGGGCACAGGGCGG + Exonic
1078901855 11:15649946-15649968 CTGGACCCCTGGGGACACAGGGG - Intergenic
1079284562 11:19117234-19117256 GTGGGCTCCTGGGGAGATGGAGG + Exonic
1081438880 11:43058464-43058486 CTGCACTGCTGGGGGCAATGGGG - Intergenic
1082767313 11:57180128-57180150 CTGGGATCCGGGAGACAAGGAGG + Intergenic
1083160126 11:60849531-60849553 CAGGACTCCAGGGGAAGAGGGGG + Intronic
1083202761 11:61130478-61130500 CGGGGCTGCTGGGGCCAAGGAGG - Exonic
1083775684 11:64893423-64893445 CTGGCCTTCGGGGCACAAGGAGG + Intergenic
1084036535 11:66514743-66514765 CTGGGCTCCTGGGAAGAACGTGG + Intronic
1084050835 11:66598892-66598914 CAGAAATCCTGGGGGCAAGGTGG + Intronic
1084563329 11:69916090-69916112 CTGGCTGCCTGAGGACAAGGCGG - Intergenic
1088930545 11:114347155-114347177 CTGGACTCCTTGGGTCAATAGGG - Intergenic
1089291209 11:117438900-117438922 CTGGATTCCAGGTGACAATGGGG - Exonic
1089351838 11:117825715-117825737 CAGGAGTCCTGGGGCGAAGGAGG - Intronic
1091885968 12:4017306-4017328 CTAGACTCAAGGGGAAAAGGGGG - Intergenic
1092210692 12:6644514-6644536 CTGGCCTCCCAGGGACAAGGAGG + Exonic
1092294941 12:7190052-7190074 CTGGACCCCGGGGGACCACGGGG - Intronic
1094329210 12:29273678-29273700 CTGAACTCCTGGGGGCAGAGGGG - Intronic
1095982259 12:47980317-47980339 CTGATCTCCTGGGGAGGAGGGGG - Intronic
1096598904 12:52715546-52715568 CTGGCCTCCTGGGAACCAGACGG + Intergenic
1096880814 12:54668304-54668326 CTGGATTCCTGAGGACAGCGGGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097642490 12:62199154-62199176 CTGGAGTACTGGGGATAAGTAGG + Intronic
1100192735 12:92209922-92209944 CTGGAGTCCTGCGGACAAGCTGG - Intergenic
1103925646 12:124422288-124422310 CTGGCCTCCTGGGCCCATGGAGG - Intronic
1104060684 12:125265666-125265688 GTGGTCACCTGGGGTCAAGGAGG - Intronic
1104830440 12:131747344-131747366 CTGGCATCATGGGGACAGGGAGG + Intronic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1112467010 13:99653345-99653367 CTGTTAGCCTGGGGACAAGGAGG + Intronic
1112551474 13:100424671-100424693 CTGGACCCTTGGGGATAGGGCGG - Intronic
1117253092 14:53954417-53954439 CTCGACTCCGGGGAACATGGTGG - Intronic
1118454187 14:65929986-65930008 CTGGACTCCAAGGACCAAGGTGG - Intergenic
1121020275 14:90575634-90575656 CTGGGCTCCTGGGGACAGGCTGG + Intronic
1121230665 14:92355253-92355275 CTGTAGACGTGGGGACAAGGAGG + Intronic
1122058606 14:99121809-99121831 CTGGCCCACTGTGGACAAGGTGG - Intergenic
1122767326 14:104081476-104081498 CTGGACTCCTGGGCCCCACGCGG + Intergenic
1122823514 14:104358835-104358857 CTGGAATCGTGGTGACAGGGTGG + Intergenic
1122891380 14:104733732-104733754 CTGGGGTCCTGGGGACAGAGTGG + Intronic
1123063719 14:105605984-105606006 CTGGCCTCCAGGGGACAGGCAGG - Intergenic
1124045791 15:26148750-26148772 CAGAGCTCCTGGGGACCAGGTGG + Intergenic
1125736306 15:41928877-41928899 CTGGTCAGCTGGGGAAAAGGGGG - Intronic
1128349928 15:66881790-66881812 CTGGAGGCCTGGGGACAGGGTGG + Intergenic
1128516600 15:68345815-68345837 TTGGACTCCTGGGGACAGGATGG + Intronic
1128885887 15:71287696-71287718 CTGGACTCCTGGGTGGCAGGGGG - Intronic
1129122999 15:73414324-73414346 CTGGGACCCTGGGGAAAAGGAGG - Intergenic
1129441095 15:75581243-75581265 CTGGACCCCAGGGAAGAAGGGGG - Intergenic
1129877815 15:78988310-78988332 CTCGACTCCTGGGCACACAGTGG + Intronic
1131236044 15:90698027-90698049 CTCAACTCCTGGGCTCAAGGGGG - Intergenic
1131293921 15:91130710-91130732 CTGCAGTCCTGGGGGCAAAGAGG + Intronic
1132006507 15:98232549-98232571 CTGGCCTGCTGGGGACATGCTGG - Intergenic
1132697560 16:1208736-1208758 GTGTGCTCCTGGGGACACGGGGG + Intronic
1133012838 16:2924511-2924533 CTGGGCTGCAGGGTACAAGGTGG + Intronic
1133016308 16:2943199-2943221 CTGGACTCCTGGGCTCAGGCAGG + Intronic
1133025786 16:2988426-2988448 CTGGGGTTCTGGAGACAAGGAGG + Intergenic
1133171084 16:3982966-3982988 CTGGAAATCTGGGGACAAGCTGG + Intronic
1133417799 16:5619834-5619856 CAGGTCCCCTGGGGACATGGGGG + Intergenic
1134046582 16:11105429-11105451 CTGGACACATGGGAACAAGGAGG + Intronic
1135197230 16:20404519-20404541 CAGGGTTCCTGGGGCCAAGGTGG + Exonic
1135254509 16:20930262-20930284 CTGGAGTCCTGGGGAAGAGATGG - Intergenic
1135400322 16:22162468-22162490 CTGCCCTCCTCGGGAGAAGGAGG + Intergenic
1135966904 16:27043146-27043168 GTGGGGGCCTGGGGACAAGGTGG - Intergenic
1137563355 16:49517020-49517042 CTGGGCTCCTCTGTACAAGGAGG - Intronic
1137613956 16:49836066-49836088 CTGGACTCCTGGGGCCTTGTGGG + Intronic
1138093744 16:54196160-54196182 TTGGACTCCTGAGGTCAATGGGG - Intergenic
1138159412 16:54739340-54739362 CAGAACTGCTGGTGACAAGGGGG + Intergenic
1141114540 16:81296984-81297006 CTGAACTGCTGGGCAGAAGGCGG + Intergenic
1141646774 16:85371741-85371763 CTGGGCCCCTGGGTACTAGGTGG + Intergenic
1141689315 16:85587508-85587530 CTGGGCTCCTGGGGACACAGCGG + Intergenic
1141929540 16:87192785-87192807 CTGGAAACCTCGGGACAGGGCGG + Intronic
1141950380 16:87335662-87335684 CAGGACTTCTGGGGTTAAGGGGG + Intronic
1142089480 16:88202447-88202469 CTGTGCTCCTGGGGACAGGTGGG - Intergenic
1142228230 16:88887702-88887724 CTGGGCTCCTGGGGACAGAGTGG - Intronic
1142282640 16:89156600-89156622 CAGGACTCCTGGTGACCAGCTGG + Intergenic
1142994001 17:3750447-3750469 CTGGAGTCCTGGGGCCACCGTGG + Exonic
1143152632 17:4816877-4816899 CTGGACTCCTTGGGACACTTGGG - Intronic
1144658945 17:17056095-17056117 CTGGACACTAGGGGCCAAGGGGG - Intronic
1144739173 17:17571661-17571683 CTGGACTCCTGGGGAGCTGGGGG - Intronic
1147653890 17:42077734-42077756 CTGGACTCCTGGGCTCTAGGAGG + Intergenic
1147925238 17:43941757-43941779 CTCCAAGCCTGGGGACAAGGGGG + Intronic
1148559858 17:48599763-48599785 CTTCACACCTGGGGACAAGAAGG + Intronic
1148623108 17:49049451-49049473 CTGGACTCGAAGGGACAGGGAGG - Exonic
1149618173 17:58019620-58019642 GTAGCCTCCTGGGGACAGGGTGG - Intergenic
1149845451 17:60006813-60006835 CCGGACTCCTGGGAACCAGCAGG + Intergenic
1150009032 17:61487923-61487945 CTGTACTCCTGGGGGCACTGGGG - Intergenic
1150389469 17:64781924-64781946 CTGGACTCCTGGCCCCCAGGAGG - Intergenic
1150560233 17:66288299-66288321 CTGGATTCTTGGGCACAAAGAGG + Intergenic
1150789975 17:68195978-68196000 CTGGACTCCTGGCCTCCAGGAGG + Intergenic
1151081843 17:71338490-71338512 CTGGACAGCTGGGGGCCAGGTGG - Intergenic
1152305495 17:79518078-79518100 TTGCAGTCCTGGGGAAAAGGAGG - Intergenic
1152563370 17:81089608-81089630 CTGCCCTCCTGCGGACGAGGGGG - Intronic
1152761035 17:82107183-82107205 CTGGTCTCCAGGGGAGAAGAGGG - Intronic
1153448104 18:5196579-5196601 CTGGCCTCCCGAGGAGAAGGAGG - Intronic
1153942416 18:9989650-9989672 CTGAACTCCAGGGGCAAAGGGGG + Intergenic
1154014687 18:10605648-10605670 GTGGGCTCCTGGGGACAGTGGGG - Intergenic
1154190800 18:12229927-12229949 GTGGGCTCCTGGGGACAGTGGGG + Intergenic
1155095799 18:22555215-22555237 CAGGACTCCTCAGGACAAGGAGG - Intergenic
1155289473 18:24326206-24326228 CTGTGCTTCTGGGGACAATGTGG + Intronic
1156557738 18:38086562-38086584 ATTGACTCCTGGGGACTAGAGGG - Intergenic
1157200266 18:45653702-45653724 CTGGGGTCCTGGGGACCTGGAGG - Intronic
1157239963 18:45999596-45999618 CTGGACTTCCTGGGCCAAGGGGG - Intronic
1158371738 18:56814021-56814043 CTAAGCTCCTGGGGACAGGGTGG - Intronic
1158748272 18:60227009-60227031 CTCCACTGCTGGGGACAATGAGG + Intergenic
1160007008 18:75075196-75075218 CTGCACTCCTGGGGACAGTGGGG + Intergenic
1160455005 18:78993682-78993704 GTTGAGGCCTGGGGACAAGGAGG - Exonic
1160831312 19:1106019-1106041 GTGGCCTCCTGGGGACAGGATGG + Intronic
1161085325 19:2332568-2332590 CAGGTCCCCTGGGGACCAGGGGG + Intronic
1161428185 19:4216081-4216103 CAGGGCCCCAGGGGACAAGGCGG - Intronic
1162341085 19:10091896-10091918 CAGGAGACCTGGGGACATGGGGG - Intronic
1162372503 19:10287850-10287872 CTGTAACCCTGGGGACTAGGAGG + Intronic
1162798754 19:13099727-13099749 CTGGTGCCCTGTGGACAAGGAGG + Exonic
1162915506 19:13872698-13872720 CTGGACACCTGGGGTGGAGGTGG + Intronic
1163041949 19:14609235-14609257 CTGGACCCCTTGTGACAAGTTGG + Intronic
1163425090 19:17236497-17236519 CCCAGCTCCTGGGGACAAGGAGG + Intronic
1163442407 19:17328641-17328663 CGGGCCTCCAGGGGGCAAGGAGG - Exonic
1163572950 19:18093582-18093604 CTGGAATCCTGGGGAAAGAGAGG - Intronic
1163678235 19:18666132-18666154 GTGGACCCGTGGGGACAAGCGGG + Intronic
1164754310 19:30678635-30678657 CTGGACTCCTAGAGCCAAGCAGG + Intronic
1164794317 19:31014145-31014167 CTGGACACCTGAGGACAGGTAGG - Intergenic
1165311491 19:35031304-35031326 CTGGGATGCTGGGGACATGGGGG + Intronic
1165448426 19:35869165-35869187 CTGGACTCCTGGGTCCTGGGAGG - Intronic
1165470971 19:36004402-36004424 GTGGGGTCCTGGGGATAAGGAGG - Intronic
1166500768 19:43339539-43339561 TTACACTCCTGGAGACAAGGTGG + Intergenic
1166505228 19:43367218-43367240 TTACACTCCTGGAGACAAGGTGG + Intergenic
1166509329 19:43393877-43393899 TTACACTCCTGGAGACAAGGTGG - Intergenic
1166666555 19:44683800-44683822 CTGGATATCTGGGGACAAGATGG + Exonic
1166794851 19:45420036-45420058 CTGGACTCCTGGGGATCTGAGGG - Intronic
1167298172 19:48663962-48663984 CTGGACTCTTGAGGAAAAGGAGG - Intronic
1167668856 19:50838563-50838585 CTGGACTCCTGGGTCTGAGGAGG + Intergenic
1167695931 19:51015689-51015711 CTGGACTCCTGGGTCTAAGTGGG - Intronic
1167738519 19:51311223-51311245 CTGGACTCCTGGGCTGAGGGAGG + Intergenic
1168004114 19:53472305-53472327 CTGGGTCCCAGGGGACAAGGTGG + Intronic
1168250187 19:55137485-55137507 CTGGACTCCTGGGCTGAGGGAGG - Intronic
1168250272 19:55137736-55137758 CTGGACTCCTGGGCTGAGGGAGG - Intronic
1168292118 19:55361973-55361995 CTGGACTCCTGGGTCTAGGGAGG - Intronic
925452623 2:3982908-3982930 CAGGACACCTGGGCACAAGGTGG - Intergenic
925708656 2:6715741-6715763 CTGCCCACCTGGGGTCAAGGTGG + Intergenic
927146028 2:20167353-20167375 GGGGACATCTGGGGACAAGGGGG - Intergenic
927195504 2:20543757-20543779 CAGGACTGCTGGGGAGGAGGCGG - Intergenic
927211912 2:20644294-20644316 AGGGACTCTTGGGGAGAAGGAGG - Intronic
927643120 2:24858213-24858235 TTGGACTCCTGGGCTCAAGAGGG + Intronic
929558829 2:42942976-42942998 CGGGCCTCCTGGAGCCAAGGGGG - Intergenic
930025088 2:47024880-47024902 CAGCACCCCTGGGGAAAAGGCGG - Intronic
933013837 2:77098390-77098412 CTGGAGTCTTTGGGACAAGATGG + Intronic
933560996 2:83885915-83885937 CAGGACTCGGGGGGAGAAGGTGG - Intergenic
934753802 2:96811186-96811208 CTGGAAGCCTGGAGAGAAGGTGG + Exonic
935337906 2:102034210-102034232 CTGGAATCTGGGGGACCAGGGGG + Intergenic
935545554 2:104396219-104396241 CTGGCCTCCTGGGGACACAAGGG - Intergenic
935761022 2:106320825-106320847 CTGGACTTCTTGGGTCAAGTGGG - Intergenic
936243216 2:110805931-110805953 CTGGGGCCCTGGGGAGAAGGAGG - Intronic
937335400 2:121059355-121059377 CTGGGCTCCTGGGGCAGAGGTGG + Intergenic
938320591 2:130359712-130359734 CTCGGGTCCTGGGGTCAAGGAGG - Intronic
940297191 2:152139469-152139491 CTGGACTCCTGGCCTCAAGCAGG - Intronic
941604746 2:167583233-167583255 CTGGCATCCAAGGGACAAGGGGG - Intergenic
942269119 2:174256562-174256584 CTCTACTTCTGGGTACAAGGAGG - Intergenic
946740922 2:222800341-222800363 CTGGGCGCCTGGGCACATGGAGG + Intergenic
947807734 2:232980258-232980280 CAGGACACAAGGGGACAAGGAGG + Intronic
948321790 2:237075844-237075866 CAGGACTCCTGGCCACAAGGAGG + Intergenic
948939915 2:241190531-241190553 ATGGCCTCCTAGTGACAAGGTGG - Intronic
948996532 2:241583024-241583046 CTGTACTCCAGGAGCCAAGGGGG - Intergenic
949027701 2:241774144-241774166 CTGGGGCCCTGGGGACAGGGAGG + Intergenic
1169360947 20:4948430-4948452 CTGGACTAGTGGGGAGCAGGGGG - Intronic
1170473163 20:16688454-16688476 CTGGACTCTTGGGGAAATGGTGG - Intergenic
1170585439 20:17730710-17730732 GTGGACACCTGGGGACATGATGG - Intronic
1170597612 20:17817498-17817520 CTTGCCTTCTGGGGACAATGTGG - Intergenic
1172005830 20:31818775-31818797 TTGGGCTCCTGGGGACACGGAGG - Intergenic
1172062415 20:32195697-32195719 CTGGAGTCCTGTTTACAAGGTGG - Exonic
1172583415 20:36065654-36065676 CTGGACAGCTGGAGAGAAGGTGG - Intergenic
1173616148 20:44404039-44404061 CTGCACTCCTGGGGACACCTGGG + Intronic
1173884586 20:46446016-46446038 ATGGGCTCCTGGGCAGAAGGGGG - Intergenic
1174078195 20:47952737-47952759 GAGGGCTCCTGGGGACAGGGTGG - Intergenic
1174088648 20:48028619-48028641 CTGGCCCCCTGGGGTCAAAGGGG + Intergenic
1174149537 20:48476414-48476436 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1175914663 20:62420034-62420056 CTGGATACCTGGGGAGAACGGGG - Intronic
1176084675 20:63290532-63290554 CTGGACTCCTGGAGCCACGGTGG - Intergenic
1176415285 21:6471186-6471208 CTGGCGTCCTGTGGACAAGGTGG + Intergenic
1179496977 21:41778231-41778253 CTGGCCCCCTGGGGGCAAGCCGG - Intergenic
1179562398 21:42223949-42223971 CTGGCCTCCTGGGGTGGAGGTGG + Intronic
1179690785 21:43079519-43079541 CTGGCGTCCTGTGGACAAGGTGG + Intergenic
1179881787 21:44296122-44296144 GTGGCCTCCTGGGGAAAACGAGG - Intronic
1179910126 21:44443063-44443085 GGGGATACCTGGGGACAAGGGGG - Exonic
1180902548 22:19385301-19385323 CTGGGCTCCTGGGGATAAGGAGG + Intronic
1180929402 22:19578810-19578832 CTGGTCTCCTGGGGACCGAGCGG - Intergenic
1181330349 22:22086226-22086248 GTGGACACCTGGGGACATGAAGG + Intergenic
1182361605 22:29749694-29749716 CTGGACACCTGGGGATTATGGGG - Intronic
1185249457 22:49792424-49792446 CTGGACTCCTGGGCACAATGGGG + Intronic
1185268417 22:49917333-49917355 CTGGATTGATGGGGACAAGAGGG - Intronic
1185339844 22:50286360-50286382 GCTGACTCCTGGGGCCAAGGTGG + Intronic
949602445 3:5614864-5614886 CCTGACTCCAAGGGACAAGGAGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950046585 3:9951972-9951994 GTGGGCACCTGCGGACAAGGCGG + Intronic
950055807 3:10023526-10023548 GGGGTTTCCTGGGGACAAGGTGG - Intergenic
950512476 3:13439437-13439459 CCCGACTCCTGAGGACAAGAAGG + Intergenic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
953795982 3:45986370-45986392 CTGGACTCCTGGAGCCACGAGGG - Intronic
954029751 3:47810642-47810664 CTGGAATCCTGAGAACAAGGAGG - Exonic
954611855 3:51948485-51948507 CAGGACCCCGGGGGACAGGGCGG - Exonic
955449338 3:59050172-59050194 CGGGACTCCTGGAGAAATGGTGG + Intergenic
955516547 3:59731675-59731697 CTGGAGTTCAGGGGACAAAGAGG + Intergenic
956905158 3:73758149-73758171 CTGGTTCCATGGGGACAAGGAGG - Intergenic
958048493 3:88316501-88316523 GAGGACTCCTGGAGAGAAGGAGG - Intergenic
961336072 3:126180428-126180450 CTGGACTCCCGGCGGAAAGGAGG - Intronic
961470242 3:127106779-127106801 CAGGCCTGCTGGGCACAAGGGGG + Intergenic
961536110 3:127572082-127572104 CTGGACTCCTGGGCTGCAGGGGG - Intergenic
961550623 3:127668758-127668780 CTTGGGTTCTGGGGACAAGGAGG + Intronic
962120896 3:132558720-132558742 CTGAACTCCTGGCCTCAAGGAGG + Exonic
962393100 3:134990625-134990647 CAGGACTCCTGGGGATACTGGGG + Intronic
962569353 3:136696333-136696355 CTGGAGTCAAGGGGCCAAGGAGG - Intronic
962971081 3:140402664-140402686 CTGCACTGCTGAGGCCAAGGAGG - Intronic
964927731 3:161978147-161978169 GTGGGCTCCAGGGAACAAGGTGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967875197 3:194264148-194264170 CTGGTGTCAGGGGGACAAGGAGG - Intergenic
968089661 3:195892370-195892392 CTGGACTGCTGGGGACTGGTTGG - Intronic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
968730606 4:2267677-2267699 CTGGGCTGATGGGGATAAGGAGG - Intergenic
969498236 4:7538422-7538444 CAGGGCTCCTGGGGCCAAGTGGG - Intronic
969844256 4:9907653-9907675 CCGAACTCCTGGGGACAATATGG + Intronic
970528996 4:16963019-16963041 CTGGACCCCAGGGAAGAAGGGGG + Intergenic
970893769 4:21078002-21078024 CAGGGCTTCTGGAGACAAGGTGG + Intronic
972158914 4:36198789-36198811 CTGCACTCTTGGGGACCAGAAGG - Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973796594 4:54433517-54433539 ATGGATTCCTGAGGACAGGGTGG + Intergenic
974331621 4:60486993-60487015 CTGGACTCCTGTTGATATGGTGG + Intergenic
975297633 4:72751914-72751936 ATGGAATGCTGGGGGCAAGGGGG + Intergenic
976445657 4:85127822-85127844 CTGGCCTGCTGGGGACAGGCTGG - Intergenic
977360652 4:96000123-96000145 CTTGACTCCTGGGGATTATGGGG + Intergenic
983576709 4:169269308-169269330 CTAGAGTCATGGGGAAAAGGGGG + Intronic
985348895 4:189036644-189036666 CTGCACTCCTTGGGAGATGGAGG - Intergenic
985604219 5:849896-849918 CTGAACTCCTGGCTAGAAGGCGG - Intronic
985631982 5:1018601-1018623 CTGTCACCCTGGGGACAAGGGGG - Intronic
985777331 5:1851608-1851630 ATGGCTTCCTGAGGACAAGGAGG - Intergenic
987865941 5:23538753-23538775 GTGTCCTCCTGGGGACAAGATGG - Intergenic
991091023 5:62694264-62694286 CTGGAGACCAGGGGACAGGGTGG - Intergenic
992132490 5:73707122-73707144 CTTTACTTCTGGGGGCAAGGTGG - Intronic
994263617 5:97688499-97688521 TTGGACACCTGAGGATAAGGAGG + Intergenic
995264210 5:110139153-110139175 CTGAACTCCTGGGGAAAGGATGG - Intergenic
996134749 5:119827123-119827145 CTGACATCCTGGGGACAAGTAGG - Intergenic
996978476 5:129461417-129461439 CGGGGCGCCCGGGGACAAGGCGG - Exonic
1001961369 5:175882128-175882150 CTGGACACAGGGGCACAAGGTGG - Exonic
1002024074 5:176384861-176384883 CTGGACCCCTGGGCCCAAGTAGG - Intronic
1002296611 5:178234829-178234851 GTGGTCTCCTAGGGACCAGGAGG + Intergenic
1003060256 6:2857411-2857433 CTGGAAGCCAGAGGACAAGGTGG + Intergenic
1004330677 6:14717689-14717711 CTGGACCCGTGGGAAGAAGGTGG + Intergenic
1004342105 6:14816956-14816978 CTGGATTCCTGGAGACAATGTGG + Intergenic
1004887217 6:20062752-20062774 CTTGACTCTTGGGGAACAGGAGG + Intergenic
1005844011 6:29763351-29763373 CTGGAGTGCTAGGGACCAGGAGG + Intergenic
1005868576 6:29956718-29956740 TTGGACTGCAGCGGACAAGGCGG + Intergenic
1006163163 6:32049628-32049650 CTTGGGTCCTGGGGAAAAGGAGG + Intronic
1006731645 6:36240427-36240449 CTGGGAGGCTGGGGACAAGGAGG - Intergenic
1007211636 6:40197270-40197292 CTGGCCTCCTGGCCTCAAGGTGG + Intergenic
1007431638 6:41780297-41780319 GGGGACCACTGGGGACAAGGGGG + Intronic
1007652470 6:43432127-43432149 CTGGACTCCTGGGGACAAGGGGG - Exonic
1010212432 6:73372642-73372664 TTGGAAGCCTGGGGACAAGTGGG + Intronic
1013011491 6:106124847-106124869 CTGGACACATGTGGCCAAGGAGG + Intergenic
1013431125 6:110055576-110055598 ATGGACTCCTGGAGACAGAGAGG + Intergenic
1013551504 6:111212007-111212029 CTGGCTTCCAGGGGACAAAGAGG - Intronic
1015882018 6:137879230-137879252 ACGGACTCCTGGGGACAGGACGG + Exonic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017143107 6:151209686-151209708 CTGGGCTCCTTGGGAAATGGAGG - Intergenic
1017322352 6:153108513-153108535 CTGAAGTTCTGGGCACAAGGGGG - Intronic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017650461 6:156576623-156576645 ATGGACTCTTGGGGAAAAGAAGG - Intergenic
1017905795 6:158756954-158756976 CTGGGCACCTGGGGAGTAGGGGG + Intronic
1019314804 7:379515-379537 CAGGACGCCTGGAGACCAGGAGG + Intergenic
1019854725 7:3593305-3593327 ATGGAGCACTGGGGACAAGGTGG + Intronic
1022470497 7:30679167-30679189 CTGGACTTCTGGGGACAGGTTGG - Intronic
1023864343 7:44231812-44231834 CAGGCCTCCTGGGGACCTGGGGG - Intronic
1025106300 7:56174584-56174606 CTGGGCTCCTGGGGCCAGCGGGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027367885 7:77477445-77477467 GTGCTCTCCTGGGGACAAAGAGG + Intergenic
1028967823 7:96822214-96822236 TTGGACTTCTGGAGATAAGGAGG - Intergenic
1031987296 7:128171438-128171460 CTGGACCCCTGGGCACAGTGGGG + Intergenic
1032121541 7:129160492-129160514 CTGGAGGCCTGGGGGCTAGGGGG + Intronic
1033165478 7:139035641-139035663 CGGGACTGCTGGTGAGAAGGCGG - Exonic
1033443116 7:141397852-141397874 CTGGGCTGCTGGGGACAGTGGGG - Intronic
1034227111 7:149492883-149492905 CTGGAATCTTGGGGCCAGGGCGG + Exonic
1034242303 7:149619948-149619970 CTGGAATCTTGGGGTCAGGGCGG + Intergenic
1034346711 7:150389729-150389751 CTAGACTCCTGGAGACACGGAGG + Intronic
1034453070 7:151148291-151148313 GTGGACTCCTGGGGAGGGGGTGG - Intergenic
1034688981 7:152998883-152998905 CAGGGCTTCTGGGGACAACGTGG + Intergenic
1035668114 8:1394164-1394186 CACGACTCCAGAGGACAAGGAGG - Intergenic
1035668156 8:1394532-1394554 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035668188 8:1394808-1394830 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035668199 8:1394899-1394921 CACGACTCCAGAGGACAAGGAGG - Intergenic
1035668209 8:1394991-1395013 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035668230 8:1395175-1395197 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035668259 8:1395405-1395427 CATGACTCCAGAGGACAAGGAGG - Intergenic
1035668363 8:1396318-1396340 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035668384 8:1396501-1396523 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035668481 8:1397371-1397393 CACGACTCCAGAGGACAAGGAGG - Intergenic
1035668731 8:1399661-1399683 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035668763 8:1399937-1399959 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035668769 8:1399983-1400005 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035668785 8:1400121-1400143 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035668907 8:1401179-1401201 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669058 8:1402529-1402551 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669094 8:1402851-1402873 CACGACTCCAGAGGACAAGGAGG - Intergenic
1035669150 8:1403311-1403333 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669171 8:1403494-1403516 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669447 8:1405924-1405946 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669468 8:1406107-1406129 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669525 8:1406633-1406655 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669557 8:1406909-1406931 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669563 8:1406955-1406977 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669574 8:1407047-1407069 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669580 8:1407093-1407115 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669586 8:1407139-1407161 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669592 8:1407185-1407207 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669598 8:1407231-1407253 CACGACTCCGGAGGACAAGGAGG - Intergenic
1035669614 8:1407369-1407391 CAGGACTCCGGAGGACAAGGAGG - Intergenic
1035669674 8:1407875-1407897 CATGACTCCAGAGGACAAGGAGG - Intergenic
1035756039 8:2033811-2033833 CTGGCCTCCTGGGGAAACTGGGG + Intergenic
1036627949 8:10487379-10487401 CTCCACACATGGGGACAAGGAGG + Intergenic
1037397503 8:18458555-18458577 CTTGACTCCTGGGCAGAACGCGG - Intergenic
1037661962 8:20935491-20935513 TTGAACTCCTGGGGAGAATGTGG - Intergenic
1037814448 8:22104411-22104433 GTGGAGTCCTGGGCAGAAGGTGG - Exonic
1038399091 8:27269426-27269448 CTGGACAGCTGGGGAAGAGGTGG - Intergenic
1038459622 8:27704990-27705012 CTGCCCTCCTGGGGAGAAGTTGG - Intergenic
1038780417 8:30564891-30564913 CTATGCTCCTGGGGACATGGAGG + Intronic
1039076001 8:33690781-33690803 CTGGGCTCCTGGGGACACTGAGG - Intergenic
1039454333 8:37697446-37697468 CTTGTCTCCCGGGGACGAGGAGG - Exonic
1040550172 8:48431511-48431533 CTGTACTGCTGGGACCAAGGGGG - Intergenic
1040661816 8:49583145-49583167 ATGGGCTCCTGGGCAAAAGGGGG + Intergenic
1040898689 8:52394449-52394471 ATGCACTTTTGGGGACAAGGAGG - Intronic
1041738902 8:61138650-61138672 CTGGACTCCTGGGGACCCACTGG - Intronic
1042877150 8:73449778-73449800 CTGGACTCCTGAGGCCCAGGAGG + Intronic
1045243314 8:100421504-100421526 CTGGCTTCCTGGGCACAAGCTGG + Intergenic
1048294966 8:133207277-133207299 CTGGACTTCAGGGGAGAAGCAGG + Intronic
1048810226 8:138278934-138278956 CTTGACTTTTGGGGAGAAGGAGG + Intronic
1049710153 8:144059783-144059805 CCGGCCTCCTGGGGACCACGTGG + Exonic
1049778341 8:144416375-144416397 CTGGGGTCCTGGGGAGAAGAGGG + Intronic
1049859747 8:144890353-144890375 CTGGTCTCCTGGGGACTCCGAGG + Exonic
1050274365 9:3981493-3981515 CCGGACTCATGGGGTCAGGGAGG - Intronic
1050289284 9:4137303-4137325 CTGAACTCCTGAAGACAAGGTGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1054999004 9:71427155-71427177 CTGGACTCCATGGTACAAGATGG - Intronic
1055114250 9:72590049-72590071 GTGCAGGCCTGGGGACAAGGAGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056759848 9:89406732-89406754 CAGGACTCCTGGATAGAAGGGGG - Intronic
1058639970 9:107074089-107074111 ATGGACTTCTGGGAACATGGGGG - Intergenic
1059340275 9:113594108-113594130 CTGGACTCCCAGGCACAAGCCGG - Intronic
1059998273 9:119934756-119934778 CTGGACTGGTGGGGTCAGGGTGG - Intergenic
1062349139 9:136130677-136130699 CTGGTGTCCTCGGGACAGGGTGG - Intergenic
1062356856 9:136169193-136169215 CTGGACTCCTGTGGCCAAGGAGG + Intergenic
1062486265 9:136777885-136777907 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1186455701 X:9708269-9708291 CAGGACACCTGGGGACCACGAGG - Intronic
1187854089 X:23619862-23619884 TTGAACACCTGAGGACAAGGAGG - Intergenic
1189746597 X:44174710-44174732 CTGGACTACTGGGAACAGGAAGG + Intronic
1190640987 X:52482603-52482625 CTGGACTCTTGAGGACCACGTGG + Intergenic
1190646685 X:52530262-52530284 CTGGACTCTTGAGGACCACGTGG - Intergenic
1190657313 X:52623623-52623645 CTGTAGTCCTGGGGCCGAGGCGG - Intergenic
1191797424 X:65035316-65035338 CTCGCCTCCTGGGGCCACGGAGG - Intergenic
1192437720 X:71153218-71153240 ATGGGCTGTTGGGGACAAGGAGG + Intronic
1195854219 X:109312900-109312922 CTGGAATCCTAGGAATAAGGGGG + Intergenic
1198130240 X:133686877-133686899 CTGGACTGCTGGGGAAGAGATGG + Intronic
1199191396 X:144975493-144975515 CTGAAGTCCTGAGAACAAGGAGG - Intergenic
1200072499 X:153536107-153536129 GTGGACACCTGGGGAGATGGAGG - Exonic
1200282664 X:154791242-154791264 TTGGACTACTGAGGCCAAGGAGG - Intronic
1201572119 Y:15425770-15425792 CTGAACTCCTGGGGCCAAGTAGG - Intergenic