ID: 1007655487

View in Genome Browser
Species Human (GRCh38)
Location 6:43448923-43448945
Sequence TGGGACTGTTCGGGAAAACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007655474_1007655487 17 Left 1007655474 6:43448883-43448905 CCCAGTTGGCTATCATCCCCCAG 0: 1
1: 0
2: 0
3: 21
4: 100
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655478_1007655487 0 Left 1007655478 6:43448900-43448922 CCCCAGGAGCCCTTTTTGTTCAG 0: 1
1: 0
2: 1
3: 20
4: 165
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655480_1007655487 -2 Left 1007655480 6:43448902-43448924 CCAGGAGCCCTTTTTGTTCAGTG 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655471_1007655487 25 Left 1007655471 6:43448875-43448897 CCCCAGATCCCAGTTGGCTATCA 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655473_1007655487 23 Left 1007655473 6:43448877-43448899 CCAGATCCCAGTTGGCTATCATC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655472_1007655487 24 Left 1007655472 6:43448876-43448898 CCCAGATCCCAGTTGGCTATCAT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655484_1007655487 -10 Left 1007655484 6:43448910-43448932 CCTTTTTGTTCAGTGGGACTGTT 0: 1
1: 0
2: 2
3: 11
4: 168
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655483_1007655487 -9 Left 1007655483 6:43448909-43448931 CCCTTTTTGTTCAGTGGGACTGT 0: 1
1: 0
2: 0
3: 10
4: 193
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655475_1007655487 16 Left 1007655475 6:43448884-43448906 CCAGTTGGCTATCATCCCCCAGG 0: 1
1: 0
2: 0
3: 22
4: 85
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655470_1007655487 26 Left 1007655470 6:43448874-43448896 CCCCCAGATCCCAGTTGGCTATC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655479_1007655487 -1 Left 1007655479 6:43448901-43448923 CCCAGGAGCCCTTTTTGTTCAGT 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114
1007655477_1007655487 1 Left 1007655477 6:43448899-43448921 CCCCCAGGAGCCCTTTTTGTTCA 0: 1
1: 0
2: 3
3: 20
4: 259
Right 1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007655487 Original CRISPR TGGGACTGTTCGGGAAAACC TGG Exonic
901626303 1:10627148-10627170 TGGGTCTGTTCTGGGGAACCCGG - Intronic
903780010 1:25815009-25815031 TGGGCCTGGTTGGGAGAACCAGG + Intronic
910414776 1:86986063-86986085 TGGGGCTGTTCTGGAAAATGTGG - Intronic
913165495 1:116180994-116181016 TGGGCCTGTTAGGGAACCCCAGG + Intergenic
915502693 1:156330244-156330266 ATGGACTTTTAGGGAAAACCTGG - Intronic
919037649 1:192335825-192335847 TGGGACTTTCAGGGAATACCAGG + Intronic
919875781 1:201866665-201866687 TGAGATTGATTGGGAAAACCAGG + Intronic
920739143 1:208563773-208563795 TGGAAATGTTTGGGAAAACATGG - Intergenic
923258865 1:232247158-232247180 TGTGACTGTTAGGGAACATCTGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063367252 10:5498905-5498927 TGGGACTCTCCGGGGAAACCTGG - Exonic
1065167699 10:22997325-22997347 GGAGACTGCCCGGGAAAACCGGG + Intronic
1065312151 10:24426856-24426878 TGGGACGCTTCGGGAAAATAAGG + Intronic
1068722474 10:60261459-60261481 TGGGAATGTTCTGGAATACCTGG - Intronic
1071130173 10:82381777-82381799 TGGGACTGTCCTGGACAAACTGG + Intronic
1072542295 10:96407213-96407235 TGGGACTGTCAGGGAACACTGGG - Intronic
1074513704 10:114143767-114143789 TAAGACTGTTTGTGAAAACCTGG + Intronic
1078492151 11:11779357-11779379 TGGGACTATCCTGGAAAATCTGG + Intergenic
1078610954 11:12819098-12819120 TGGGATTGTCCTGGAAAATCTGG + Intronic
1078863786 11:15277888-15277910 TGGGACTGATCAGGAAACCTTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081621577 11:44622047-44622069 TGGGGCTGTTCTGGGAAATCTGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083203098 11:61131986-61132008 GGGGACTGTTGAGGATAACCAGG + Exonic
1084002833 11:66306882-66306904 CGGGACTGGTCTGGAAATCCTGG - Intergenic
1088609999 11:111567789-111567811 TGGGACTTTTGGGGCAACCCTGG - Intergenic
1088927444 11:114316612-114316634 TGGGACCCTTCTGGAAAACAGGG + Intergenic
1092155566 12:6279573-6279595 TGGGACTATGCGGGCAAACGGGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095399259 12:41795794-41795816 TGGGACTGTACAGCAAAATCCGG + Intergenic
1097392442 12:59032123-59032145 TGGGACTGTTCTGGTTAAACTGG + Intergenic
1102540424 12:113615074-113615096 TGGGACTTTTCCCAAAAACCTGG - Intergenic
1103218788 12:119225762-119225784 GGGGACTGGTCAGGAATACCTGG + Intergenic
1103569063 12:121832173-121832195 TGGGGGTGTTCGAGAAGACCAGG + Exonic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1108192795 13:47959539-47959561 TGGGACTGATCGGAAAGCCCAGG + Intronic
1113887004 13:113666292-113666314 TGGGACAGCTGGGGAACACCTGG - Intergenic
1117026136 14:51621994-51622016 CGAGACTGTTCTGGCAAACCAGG + Intronic
1118341945 14:64901462-64901484 TGGGACTGTCCAGGACAAGCTGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119486183 14:74988632-74988654 TGGGACATTTCTGGAAAATCTGG + Intergenic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1127836551 15:62795274-62795296 TGGGAGTGTTTGGGAAAGTCAGG + Intronic
1128148317 15:65344983-65345005 TGGGACTGCTTTTGAAAACCTGG - Intronic
1130620757 15:85459802-85459824 TGGTACTGTTAAGGAAAAGCAGG - Intronic
1130964547 15:88687126-88687148 AGGGACTGTTAGGGAAGCCCAGG - Intergenic
1136056205 16:27691627-27691649 TAGGACGGTTCTGGAAAGCCAGG + Intronic
1140206546 16:72938165-72938187 AGAGACAGTTCTGGAAAACCAGG + Intronic
1141141957 16:81502270-81502292 TGGGACTGTCCAGGCAAAACAGG - Intronic
1142124460 16:88403229-88403251 AGGGACTGTTCTGGGCAACCAGG - Intergenic
1151001596 17:70382798-70382820 TGGGAGAGTTCGGGAGAATCTGG + Intergenic
1153178486 18:2405972-2405994 TGGGACAGTTGGGGCACACCGGG + Intergenic
1163851702 19:19668139-19668161 AGGGCCTGCTCCGGAAAACCAGG + Intergenic
1164790046 19:30969646-30969668 TGTTACTGTTGGGGAAAACTGGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166999534 19:46737844-46737866 GGGGACGGTGCGGGAAAGCCGGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925646258 2:6040023-6040045 TGGGACTGTACGTGGACACCTGG - Intergenic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
927147333 2:20174857-20174879 TGGAACTGTCCAGGCAAACCAGG - Intergenic
932077864 2:68681878-68681900 TGGGAGTGCTGGGGATAACCAGG + Intronic
933766579 2:85713285-85713307 TGGGATAGTTCCAGAAAACCAGG - Intergenic
935242515 2:101190831-101190853 TGGGAGTGGGAGGGAAAACCTGG - Intronic
935691860 2:105739528-105739550 CGGGGCTGTACAGGAAAACCAGG + Intergenic
937281312 2:120719334-120719356 TGGAACTGTTCCAGAAGACCTGG - Intergenic
937963484 2:127482473-127482495 TGGGACTGTCCAGGAAATCTGGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
946603219 2:221374001-221374023 TGGGACTGTCCTGGCAAACCAGG + Intergenic
946953436 2:224902621-224902643 TGAGACTGTTCCTGCAAACCAGG + Intronic
1171221963 20:23406274-23406296 TGGGAGTGTTGGGGAAAAGCAGG + Intronic
1171313039 20:24161128-24161150 TGGGACTGTTCTTGAAGTCCAGG + Intergenic
1172616038 20:36285414-36285436 TGGGATCCTTCGGGAAATCCTGG + Intergenic
1173708663 20:45135619-45135641 TGGGTCTGTTAGGGCAATCCTGG + Intergenic
1179343768 21:40537095-40537117 TGAGAATGTTCTGGAAAGCCAGG - Intronic
1184426276 22:44410915-44410937 TGGGACTGTTCTGGAGGACAAGG + Intergenic
951918068 3:27822603-27822625 TGGGACAGTCCAGGAAAACGGGG + Intergenic
959064234 3:101640890-101640912 TGGGGCTGCTCGGCGAAACCTGG - Intergenic
960594436 3:119395424-119395446 TGGGACAGCTGGGGAAAACATGG - Intronic
961430130 3:126875387-126875409 TGGGACTGTTGGGGAGCACATGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961644456 3:128385179-128385201 TGGGACTGCTCTGGAGAGCCTGG - Intronic
966439364 3:179926682-179926704 TGAGGCTGTTCAGGAAACCCTGG + Intronic
971289476 4:25323643-25323665 TGGGACTGTCCTGGGCAACCAGG + Intronic
974433412 4:61827777-61827799 TGGTACTGTTCTGGAAGACAAGG + Intronic
984200214 4:176710460-176710482 AGGGACAGTTTAGGAAAACCTGG - Intronic
992118420 5:73565229-73565251 TGGGACTTTTCGGGCACAGCTGG - Exonic
992190515 5:74287095-74287117 TGTTACTGTTCTGGAAAGCCTGG - Intergenic
993618376 5:90139169-90139191 TGGGACTGTTCAGGAAGACTTGG - Intergenic
994059373 5:95457045-95457067 TGAGACTGTTGAGGAAGACCTGG - Intergenic
1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG + Exonic
1008150873 6:47949760-47949782 AGGGAATGTTGGGGAAAACATGG - Intronic
1011233293 6:85187770-85187792 TGGGGCTGTTGGGGAAAGCATGG + Intergenic
1013400525 6:109791481-109791503 TGGGACTGATCGGGAAGAAGAGG + Exonic
1014826723 6:126055347-126055369 AGGGAGTGTTAGAGAAAACCAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015534814 6:134257110-134257132 GGAGACTGTTTGGGAATACCAGG + Intronic
1017587369 6:155941893-155941915 TGGGAATGTTTGGGAGAACGAGG - Intergenic
1018712550 6:166507094-166507116 TGGGGCTGTTCGGGAGCATCGGG - Intronic
1018837839 6:167498495-167498517 TGTGACTGTGTGTGAAAACCTGG + Intergenic
1023943893 7:44788027-44788049 TGGGATTGGACAGGAAAACCAGG - Intergenic
1024127977 7:46320315-46320337 TGGGACAGCTCAGGCAAACCAGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031201754 7:118697286-118697308 TGGGACTGCTGGCGCAAACCTGG - Intergenic
1032906422 7:136372719-136372741 TGGGACTATCTGGGAAAACAGGG - Intergenic
1035925286 8:3721384-3721406 TGGGACTGATCCTAAAAACCTGG - Intronic
1051310715 9:15768054-15768076 TGGGACTGCTCGGGACAACAAGG - Intronic
1053265823 9:36712559-36712581 TGGCACTGTTCATGAAAAGCAGG - Intergenic
1053374452 9:37593230-37593252 TGAGACTGTTCTGGAACTCCTGG + Intronic
1055172276 9:73273357-73273379 TGAGACTGTTCTGGGAAAACTGG + Intergenic
1056299633 9:85227715-85227737 TGGGACTGTTCTGGAAGGCAAGG + Intergenic
1056493856 9:87136390-87136412 TGGAACTGTTCAGGTAAACCGGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060192145 9:121599918-121599940 GGGGACTGTAGGGGAAAAGCGGG - Intronic
1186057506 X:5665607-5665629 TGGGACTCTTGGGCAAAAGCGGG - Intergenic
1190708514 X:53049253-53049275 TGGGGGTGTTGGGGAACACCAGG - Exonic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193593296 X:83416897-83416919 TGTAACTGTCCAGGAAAACCAGG - Intergenic
1194752967 X:97705085-97705107 TGGGACTGTGCAGGAAAAGCAGG + Intergenic
1195173679 X:102294454-102294476 TGAGACTGTTCAGGAAGAACAGG + Intergenic
1199678676 X:150208976-150208998 TGGTACCATTGGGGAAAACCAGG - Intergenic
1200045462 X:153398512-153398534 TGGGGCTGTGCAGGAAAACTGGG + Intergenic