ID: 1007655601

View in Genome Browser
Species Human (GRCh38)
Location 6:43449405-43449427
Sequence CAGGATCTGGAATATGGGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007655601_1007655607 5 Left 1007655601 6:43449405-43449427 CCATTCCCATATTCCAGATCCTG 0: 1
1: 0
2: 1
3: 28
4: 337
Right 1007655607 6:43449433-43449455 CGATGAGGCCACAGCAAGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 135
1007655601_1007655605 -10 Left 1007655601 6:43449405-43449427 CCATTCCCATATTCCAGATCCTG 0: 1
1: 0
2: 1
3: 28
4: 337
Right 1007655605 6:43449418-43449440 CCAGATCCTGTGTATCGATGAGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007655601 Original CRISPR CAGGATCTGGAATATGGGAA TGG (reversed) Exonic
900879990 1:5373944-5373966 CAAGATTTGGATTATGGGAGGGG - Intergenic
901304804 1:8225128-8225150 CAGGATCAGGAATAAGGGCTTGG - Intergenic
902135560 1:14301803-14301825 CAAGACCTGGAAGATGAGAATGG - Intergenic
902483274 1:16724015-16724037 GAGGAGATAGAATATGGGAATGG + Intergenic
903601600 1:24546128-24546150 GAGGATCAGGAATCTGGGAGTGG + Intergenic
903882021 1:26517025-26517047 CAGGATCTGAGAGAGGGGAAGGG + Intergenic
905771580 1:40641570-40641592 CAGCACCTGGTGTATGGGAAGGG + Intronic
906935084 1:50207764-50207786 CAGTATCTGGCATATGGCAGGGG - Intergenic
907723430 1:56995844-56995866 CATGAACGGGAAGATGGGAAAGG - Exonic
907739071 1:57146210-57146232 CATCATCTGGAAAATGGAAATGG - Intronic
909944029 1:81643008-81643030 CAAGATCAGGAATAAGGCAAGGG + Intronic
912170347 1:107092150-107092172 CAGCCTCTGGAATCTGGGAAAGG + Intergenic
912926043 1:113914015-113914037 CAAAATGTTGAATATGGGAATGG - Exonic
914794303 1:150907049-150907071 CAGGATCAGGAAGAAAGGAAGGG - Intergenic
914830564 1:151167988-151168010 CAGAATCATGAATTTGGGAAAGG - Intronic
916078635 1:161218224-161218246 TTGGATCTGGAATGGGGGAAAGG - Exonic
917241003 1:172948809-172948831 CTGCAGCTGGGATATGGGAATGG - Intergenic
918239432 1:182609009-182609031 CAGGAAGTGGAAAATGTGAATGG - Intergenic
919163938 1:193868392-193868414 CAGGATTTCAAATAAGGGAAAGG + Intergenic
919746106 1:201010161-201010183 CAGGCTCTGGCATCTGGGAAGGG - Intronic
920819193 1:209364601-209364623 CAGGCTTTGGGATTTGGGAATGG + Intergenic
920836241 1:209513695-209513717 CAGGATGTGGAATAGGGGCACGG - Intergenic
920900383 1:210104645-210104667 CAGGATGAGGAAAAAGGGAAAGG - Intronic
921161862 1:212478595-212478617 CAGGTTCGGGAAAATGGGCAGGG + Intergenic
921480455 1:215659003-215659025 CAGCATCTGGCATATAGAAATGG - Intronic
921890687 1:220350822-220350844 CAGGATCTTTAATATGTTAATGG + Intergenic
921975285 1:221196084-221196106 CATGATCTGGGATCTGGCAAAGG - Intergenic
922089535 1:222382486-222382508 TGGGCTCTGGAATATGGGAACGG + Intergenic
922725765 1:227922338-227922360 CAGGACTGGGATTATGGGAATGG - Intronic
924625561 1:245694427-245694449 CAGGAGCAGGAGTTTGGGAATGG + Intronic
1063064308 10:2592922-2592944 CAGGATCTGGAAGAAAGGGAGGG - Intergenic
1063184149 10:3635255-3635277 CAGGGCCAGGAATAGGGGAAAGG + Intergenic
1063287529 10:4706798-4706820 CAGGATATAAAAAATGGGAAGGG + Intergenic
1064229795 10:13520095-13520117 CTGGATCTGGAATTTGGACATGG - Intronic
1067277982 10:44851359-44851381 CAGAATCTAGAAGATTGGAAGGG + Intergenic
1069627365 10:69876596-69876618 CAGGATCTGGAGTTAGAGAACGG - Intronic
1071499188 10:86191508-86191530 CAGGATAGGGAGTCTGGGAAGGG - Intronic
1071766859 10:88676544-88676566 GGGGATCTGGGATATGGGACAGG - Intronic
1072031590 10:91527076-91527098 CAGCATCTGGAAGCTGGAAAAGG - Intergenic
1072164654 10:92801654-92801676 CAGAATGGGGAAAATGGGAAAGG - Intergenic
1072817687 10:98525712-98525734 CAGGAAGTGAAATATGGGAGTGG + Intronic
1077796315 11:5496545-5496567 CAGGATCTAGACTTTAGGAAGGG - Intronic
1078012177 11:7580958-7580980 CTTGATCTGGAGTATGGGAAGGG - Intronic
1078085246 11:8229949-8229971 CCTGATCTGGAATCTGGGAGGGG - Intronic
1080089144 11:28323838-28323860 CCTGATCTGGAATGTGAGAATGG + Intronic
1080203109 11:29696949-29696971 AAACATCTGGAATATGGCAAAGG - Intergenic
1081157212 11:39708225-39708247 CAGTTTCTTGAATGTGGGAATGG - Intergenic
1081388249 11:42498881-42498903 AATGATCTGGAAAATGGAAAGGG - Intergenic
1081642772 11:44767672-44767694 CATGATCTCGAATTTGGCAATGG - Intronic
1081728377 11:45349643-45349665 CATTATCTGGATTATGGTAATGG - Intergenic
1082063419 11:47879648-47879670 CAAGAACTGGAATATGCAAATGG + Intergenic
1082082757 11:48025076-48025098 CAGGCTATGGGATCTGGGAAAGG + Intronic
1083744853 11:64729793-64729815 CAGGATCTGCAATAGAGGAGGGG + Exonic
1085333348 11:75670494-75670516 CAACATCTGGCATATGGCAATGG + Intergenic
1085608301 11:77922833-77922855 CAGTCACTGGAAAATGGGAATGG - Intronic
1085847907 11:80086807-80086829 CAGAATCTAGAATAAGGGAAGGG - Intergenic
1087269304 11:96095245-96095267 AATGATGAGGAATATGGGAATGG + Intronic
1087360601 11:97154282-97154304 CAAAAGCTGCAATATGGGAAAGG - Intergenic
1089513022 11:119012586-119012608 CAGGATATGGGAGATGGAAAAGG - Intronic
1091687845 12:2576254-2576276 CAGCAGCTGGAGAATGGGAAAGG + Intronic
1091716937 12:2784254-2784276 CAGGATCGGGAAGCTGGAAAAGG + Intergenic
1092364990 12:7870588-7870610 GAGGATGTGGAATAGTGGAAGGG - Intronic
1092913746 12:13171364-13171386 TAGGATTTGGAGTGTGGGAATGG + Intergenic
1092989792 12:13885560-13885582 CAGGATTTGGATTATAGGCAGGG - Intronic
1093666177 12:21815888-21815910 AAGGATCTGGAGGATGGGATGGG + Exonic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1096316591 12:50572644-50572666 CATTATCTGGGATATGGCAAAGG - Intronic
1097587702 12:61534147-61534169 CTGGATCTTGAAGATGGGTAGGG - Intergenic
1098393098 12:69990302-69990324 CAGGACCTGGAAAATGAGCAAGG - Intergenic
1098822439 12:75249993-75250015 CAGCATCTAGAATCTGGAAAAGG - Intergenic
1101901804 12:108796358-108796380 CAGGGACTGGAAGAAGGGAATGG - Intronic
1102246673 12:111360928-111360950 CAGGATCTGGGGCATGGGAGGGG - Exonic
1102418688 12:112786951-112786973 CAGGCTCTAGAAAATGGAAAAGG - Intronic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102751117 12:115295567-115295589 CAACATCTGAAAAATGGGAAGGG - Intergenic
1102760719 12:115382466-115382488 CAGTGTCTGGTACATGGGAAGGG + Intergenic
1103586332 12:121959023-121959045 CTGGTTCTGGAATATTTGAAAGG - Exonic
1104172743 12:126298182-126298204 GAGGGTCAGGAATCTGGGAAAGG + Intergenic
1104362895 12:128150710-128150732 CAGCATCTGGAATTTGGCACTGG + Intergenic
1104477968 12:129085649-129085671 CCTCATCTGGAATGTGGGAATGG - Intronic
1106367685 13:29098525-29098547 AAAGATCTGGACTATGGGAAAGG + Intronic
1106564568 13:30873092-30873114 GAGGATCTGGAAGAAGGGAAGGG + Intergenic
1107171774 13:37350837-37350859 GAGGAACTGGAAAATGGCAATGG - Intergenic
1108605669 13:52036120-52036142 CAGCCTCTGGAATCTGGAAAAGG - Intronic
1110518725 13:76448515-76448537 GAGAATCTGGAATCTGGGTATGG + Intergenic
1111057005 13:82964303-82964325 CATGATATGGAAGATGGGATTGG - Intergenic
1111149875 13:84236945-84236967 CAGCCTCTGAAATATGAGAATGG - Intergenic
1111863115 13:93733648-93733670 CATGAGATGGACTATGGGAATGG - Intronic
1113825801 13:113252151-113252173 CAGGATCCGGGCGATGGGAAAGG + Intronic
1115196748 14:30808839-30808861 CAGGATCTGGTATAAGTCAATGG - Intergenic
1118298288 14:64590798-64590820 CTGGATATTGAATCTGGGAAAGG - Intergenic
1118327236 14:64789858-64789880 CAGGATTTGGAATATGTAGAGGG + Intronic
1119041669 14:71280008-71280030 CAAGGTCTGGAAAATGTGAATGG - Intergenic
1119102296 14:71891234-71891256 CAGGGCCAGGAATTTGGGAAGGG + Intergenic
1120115214 14:80608594-80608616 CAGAATTTAGAATATGGAAAGGG - Intronic
1120202479 14:81553063-81553085 CAGTTTCTAGAATATGGAAAAGG + Intergenic
1120209130 14:81616919-81616941 CAGGATTAGGATTATGGGAGGGG + Intergenic
1121271949 14:92643494-92643516 CAGGATCTTGGATGTGGGACAGG + Intronic
1121326088 14:93020315-93020337 CAGGATCTGGAACTGGGGAGGGG + Intronic
1121888401 14:97565993-97566015 CAGAACCTGGTATATGGGAGAGG + Intergenic
1124683427 15:31757119-31757141 CAGGAGCTGGGGTATGGGAGTGG - Intronic
1124844946 15:33281172-33281194 CTGGAGCAGGAATATGGGGAAGG - Intergenic
1125011438 15:34880345-34880367 CAGAATCTGACATATGAGAAAGG + Intronic
1125663881 15:41415580-41415602 CAGGATTTGGGATAGGGGTAAGG - Intronic
1126344679 15:47680287-47680309 CAGGCTGTGGGATATGGGGATGG - Intronic
1126465536 15:48958278-48958300 CAGCCTCTGAAGTATGGGAATGG - Intronic
1126883986 15:53130161-53130183 CAGGATCTGGCTCCTGGGAATGG + Intergenic
1127535589 15:59886947-59886969 CAGGATCTAGATTAGGGGATGGG - Intergenic
1128330614 15:66753229-66753251 TAGGATCTGGGATGTGGGAAAGG + Intronic
1128776174 15:70322145-70322167 CAGGAAATGGCATGTGGGAAAGG - Intergenic
1129301211 15:74626601-74626623 CAGGATCTGCAAGATGGGACAGG + Intronic
1129579108 15:76786565-76786587 CCAGATCTGGAACAAGGGAAAGG + Intronic
1131116462 15:89799149-89799171 CAGCACGTGGCATATGGGAAGGG + Intronic
1135984548 16:27174456-27174478 CAGGGTCTGGAATCTGGGGGAGG - Intergenic
1136513712 16:30755324-30755346 CATGATGTGGAATCAGGGAAGGG + Intronic
1138674014 16:58637892-58637914 CAAGATTAGGAGTATGGGAAGGG + Intergenic
1138865818 16:60818094-60818116 CAGGATTTGGAGTAGGGCAAGGG + Intergenic
1141016225 16:80452655-80452677 CAGCATCTTGGATATGGGAATGG - Intergenic
1141206250 16:81935202-81935224 CAGAAACTGGAAGAAGGGAATGG - Intronic
1141206897 16:81939619-81939641 CAGGATCAGGGACAAGGGAACGG - Intronic
1142160368 16:88554462-88554484 CAGCCTCTGGAAGCTGGGAAAGG - Intergenic
1142614303 17:1125856-1125878 CAGGTTCTGGAGTGTGGGAGGGG + Intronic
1142889142 17:2931708-2931730 CATTAACTGGAAGATGGGAAAGG + Intronic
1143408901 17:6696725-6696747 CTGGAACTGGAATGTGTGAATGG - Intronic
1143446597 17:7013649-7013671 CATTATCTGGAAAAGGGGAATGG - Exonic
1143899613 17:10164139-10164161 CAGGATTAGGAATATGGCCATGG + Intronic
1143911349 17:10252392-10252414 GAGGATCTGGAATTTGGGTGTGG + Intergenic
1144274285 17:13650294-13650316 GAGGATTTGAAATGTGGGAAAGG + Intergenic
1144526357 17:15993773-15993795 CAGGAACTGTAAAATGAGAATGG + Exonic
1144763566 17:17721020-17721042 CAGAATCTGGAATCTGTGAAGGG + Intronic
1147123306 17:38349125-38349147 CAGGATCTGGGCTACGGAAATGG + Intergenic
1150506715 17:65706369-65706391 CAGGACCTGGAATATGTGAAGGG + Intronic
1151172157 17:72255991-72256013 CAGGATCTCAAATATGTGAAGGG - Intergenic
1151703408 17:75754852-75754874 CAGGAGCTGGAAGAGAGGAAGGG - Intronic
1152718063 17:81909328-81909350 CAGGAAATGCAAGATGGGAAAGG + Intronic
1152970224 18:154430-154452 CAGTATCTAGAATCTGGGAAGGG + Intergenic
1153084785 18:1271814-1271836 AAGGAACTGGAATGTGGGGAAGG + Intergenic
1153818177 18:8808993-8809015 CAAGAACTGGAATGTGGAAAAGG + Intronic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1156698067 18:39791885-39791907 CAGGTTCTTGAATATGGAGAGGG + Intergenic
1158185133 18:54762816-54762838 AAGGAGCTGTAATATGCGAATGG - Intronic
1158295649 18:55994278-55994300 GAGGATCTGGAATGGGGGCAGGG - Intergenic
1158586926 18:58747275-58747297 GAGGATTTGGAACCTGGGAAAGG + Intronic
1159083893 18:63765688-63765710 CAGGATCTAAAATATAAGAATGG - Intronic
1160864677 19:1251421-1251443 CTGGATCTGGAAGCCGGGAAGGG + Intronic
1161185443 19:2915715-2915737 CAAGATGTGAAATGTGGGAAAGG + Intronic
1162084794 19:8242038-8242060 CAGAGTCTGGCATATGGGAGGGG - Intronic
1162503409 19:11067664-11067686 AAGGGTCAGGAATGTGGGAAGGG - Intergenic
1162685830 19:12383471-12383493 GAAGATTTGGAATATGGAAAGGG - Intronic
1162686770 19:12393206-12393228 AAAGATTTGGAATATGGAAAGGG - Intronic
1162691122 19:12432980-12433002 AAAGATTTGGAATATGGAAAGGG - Intronic
1165645967 19:37437409-37437431 TAAGATCTGGAATATGACAAGGG + Intronic
1166093427 19:40524946-40524968 CTGGGTCTGGAAGATGAGAAAGG - Intronic
1166486393 19:43217344-43217366 AAGGATTTGGAATGTGAGAAAGG - Intronic
1166822031 19:45586467-45586489 AACGATCTGTAAAATGGGAAGGG - Intronic
1167579393 19:50332868-50332890 CAGGCCCTGGAATTGGGGAAGGG + Intronic
1167647582 19:50714001-50714023 CAGAGCCTGGAAAATGGGAAGGG - Intronic
926007449 2:9383616-9383638 CAAGATTAGGATTATGGGAAGGG - Intronic
926066842 2:9847571-9847593 CACGCTCTGCAATCTGGGAAAGG + Intronic
927039578 2:19214719-19214741 CAGTATCTGGAATAGGCAAAGGG - Intergenic
927184468 2:20472546-20472568 CAGGAACTGAAAAATGGGAAGGG + Intergenic
927192697 2:20527698-20527720 CAGGACCTGGAAGAAGGGAGAGG - Intergenic
927226771 2:20774045-20774067 CAGGATCTGACACATGGAAAGGG + Intronic
927786268 2:25977357-25977379 CATGAACTGGAAGAAGGGAATGG + Intronic
927894308 2:26771613-26771635 CAGGACATGGAACATGGGTAAGG - Intronic
928610647 2:32988707-32988729 CAGCATGTGGAAGGTGGGAAAGG - Intronic
929419587 2:41777278-41777300 CATGATCTAGAACATGGAAATGG - Intergenic
929528281 2:42726629-42726651 CAGGTTCTTGATGATGGGAAAGG + Intronic
930945018 2:57062762-57062784 CAGGGTCAGGATTCTGGGAATGG - Intergenic
932273611 2:70434314-70434336 TAGGATATGGGATATGGGATAGG - Intergenic
936166546 2:110125139-110125161 CAGGATTTGGCAAATGGGAAGGG - Intronic
936637008 2:114270463-114270485 CAGAAACTGGAATAGGAGAAAGG + Intergenic
938528891 2:132163017-132163039 CAGCATCTGGAGTATGGCAGTGG + Intronic
938801761 2:134770422-134770444 CAGGCTCTGGAAGCTGGAAAAGG - Intergenic
941091277 2:161179265-161179287 TAGGATCAGCAATGTGGGAAGGG - Intronic
941573661 2:167202897-167202919 CAGCTTCTGGAACCTGGGAAGGG - Intronic
941865654 2:170331785-170331807 CAGCATCTGGAAGATGGAAACGG - Intronic
942946132 2:181676237-181676259 CATTATTTGGAATATGGGACTGG - Intronic
943910313 2:193557012-193557034 CAGTGGCTGGAATATGTGAAAGG + Intergenic
946338866 2:219055981-219056003 CAGGAGCTGGGATATGGTGACGG - Intronic
946582211 2:221141986-221142008 CAGCGTCTGGAAGCTGGGAAAGG - Intergenic
946894929 2:224313956-224313978 CAGGATCAGGACTCTGGGGAAGG - Intergenic
947294725 2:228617800-228617822 CAGGATAAGGTATGTGGGAAGGG - Intergenic
947346322 2:229193098-229193120 ATGGATCAGGAATATGGGCAGGG + Intronic
948762267 2:240199470-240199492 CAGGTTCCGGAACAAGGGAAGGG + Intergenic
1169931207 20:10835018-10835040 TAGGATCTGGAATCTTGGAAGGG + Intergenic
1171121604 20:22573265-22573287 CAGAATCTGGAAAATGAGTAGGG - Intergenic
1171238755 20:23548362-23548384 CAGGCTCTGGATTAGGGGAGGGG + Intergenic
1171242850 20:23585876-23585898 CAGGCTCTGGATTAGGGGAGGGG - Intergenic
1171492028 20:25526702-25526724 CAGGAGCTGGCATGTGGGGAAGG + Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172206148 20:33164260-33164282 GAGGATCTGGAAGATGAGAGAGG + Intronic
1173123948 20:40319415-40319437 GAGAATCAGGAATTTGGGAAGGG - Intergenic
1173131281 20:40396198-40396220 CAGTAGCTGAAATATGGAAATGG - Intergenic
1173168638 20:40704419-40704441 CAGCATCTGGAAAATGGGCCTGG + Intergenic
1174274717 20:49395490-49395512 CTGGATCAGGAATATGCGGATGG + Intronic
1174366507 20:50059793-50059815 CAGGAGCTGGAATAAGGTGAAGG + Intergenic
1175741766 20:61424882-61424904 CATGCTCTTGAAGATGGGAAAGG + Intronic
1175966910 20:62664418-62664440 CAGGCCCTGGGATAGGGGAATGG - Intronic
1176277484 20:64280620-64280642 CTGGATCTGGAATGAGGAAACGG + Intronic
1176767614 21:13036895-13036917 CAGCATCTGGAGTATGGCAGTGG - Intergenic
1177405729 21:20665398-20665420 CTGGATCTGTGATATGGGAAAGG + Intergenic
1177967606 21:27747614-27747636 CAGGACCTGGGATTAGGGAAAGG - Intergenic
1178585005 21:33864365-33864387 CAGCATCTGGAAGAAGGGCATGG - Intronic
1178660447 21:34503326-34503348 CAGGATGAGGTATGTGGGAAGGG + Intergenic
1179067815 21:38042636-38042658 CAGGATCTGGCCAATGGGATTGG - Intronic
1179293523 21:40040753-40040775 CTGCATCTGTAAAATGGGAATGG - Intronic
1180432173 22:15263196-15263218 CAGCATCTGGAATATGGCGGTGG - Intergenic
1183101530 22:35587103-35587125 GAGGATCAGGAATTTGGGACTGG - Intergenic
1183937615 22:41272429-41272451 CAGGAGGAGGAATATGGGACTGG - Intronic
1183991283 22:41598619-41598641 CTGGATCTGGAAGAGGAGAAAGG + Exonic
1184674405 22:46032631-46032653 CAGGCTCTGGACTCTGGGGAAGG - Intergenic
950486500 3:13276965-13276987 CAAGAACTGGAATAGGGGAGAGG - Intergenic
950753641 3:15153774-15153796 CAGGAGCTGGAATTTGGCAGAGG - Intergenic
950911126 3:16593230-16593252 GTGGAACTGGAATATAGGAAAGG + Intronic
952223324 3:31347276-31347298 CAGAATCATGAAAATGGGAATGG - Intergenic
952265117 3:31777925-31777947 CAGCAGGTGGAATCTGGGAAAGG + Intronic
953961136 3:47266804-47266826 CAGGATTTGCAAAAAGGGAACGG - Intronic
954194003 3:48985347-48985369 CATCATCAGGAAGATGGGAAAGG + Exonic
954889486 3:53911601-53911623 CACGATCAGGAATTTGGCAACGG + Intergenic
954977755 3:54712715-54712737 CAGCCTCTGGAAAATGGAAAAGG - Intronic
955133919 3:56197249-56197271 CAGTATCTGTAAAATGGGAATGG + Intronic
955921257 3:63958162-63958184 CAGGATTTGTAATATGTGCAAGG - Intronic
956594037 3:70947138-70947160 CTGGAGCTATAATATGGGAAAGG - Intergenic
957775668 3:84755283-84755305 GAGTATATGGAATATGGGAAAGG - Intergenic
958454638 3:94315421-94315443 CTGGATCAGGAATTTGGAAAGGG + Intergenic
958829260 3:99067811-99067833 CAGGAGCTGGAATAATAGAAAGG - Intergenic
958934774 3:100244576-100244598 CAGGATTTAGAATCTGTGAAAGG - Intergenic
959368531 3:105493630-105493652 CAGCTTCTGGAAAATGGAAAAGG + Intronic
960863914 3:122181356-122181378 CACGATATGGAATTTGGGGATGG + Intergenic
962341797 3:134592019-134592041 CAGGGTCAGGAATTTAGGAATGG + Intergenic
963323632 3:143836881-143836903 CAGGATTTGGCAGAAGGGAAGGG - Intronic
964565881 3:158051956-158051978 CAGCATCTGACATATGGAAAAGG + Intergenic
967943821 3:194786768-194786790 CAGCATCTGGCATATAGAAAGGG - Intergenic
968492550 4:897975-897997 CAGGGCGTGGAATGTGGGAAGGG + Intronic
968748334 4:2372607-2372629 CAGGGCCTGGATTCTGGGAAGGG + Intronic
970280254 4:14447044-14447066 CTGGTTCTGGAATATGTTAATGG + Intergenic
971312238 4:25535397-25535419 CAGGACATGGAATATGGGGGAGG + Intergenic
971386117 4:26141811-26141833 CAGGAACTGGAGGCTGGGAAGGG - Intergenic
971710720 4:30107673-30107695 TAGAGTCTGGAACATGGGAAGGG + Intergenic
971854220 4:32023278-32023300 TAGGTTCTTAAATATGGGAATGG - Intergenic
974594047 4:63994620-63994642 TAGCATCTGGTATATGGGGAAGG - Intergenic
975977037 4:80111162-80111184 CAGAAACTGGAATTTGCGAAAGG + Intronic
976119135 4:81760873-81760895 CAGCATATGGAATATGGAATTGG + Intronic
976145196 4:82035772-82035794 TAGTGTCTGGAATATGGTAATGG - Intronic
978256594 4:106699683-106699705 GAGTATCTGGAGTATGGAAAAGG + Intergenic
981102415 4:140844006-140844028 CACCATCTTGAATCTGGGAAGGG + Intergenic
983061292 4:163164646-163164668 GAGGATCTGGGTTATGGCAAAGG - Intronic
983953618 4:173672089-173672111 AATGATCTGGAATAAGGTAATGG + Intergenic
984744605 4:183202144-183202166 CAGACTCTGGGTTATGGGAATGG + Intronic
985563514 5:603772-603794 CAGGAGCTGGAGCATGGGAGTGG - Intergenic
986447274 5:7832339-7832361 CAGGATCTGGGTGGTGGGAAGGG - Intronic
987299834 5:16587617-16587639 CAGGGTCAGGTATATTGGAATGG - Intronic
987491239 5:18582727-18582749 CAAGATGAGGATTATGGGAAAGG - Intergenic
989985888 5:50697377-50697399 CAGGATTTGAAATATGAGATAGG - Intronic
990080101 5:51902040-51902062 CAAAATCTGGAGTATGTGAATGG + Intergenic
990244800 5:53853976-53853998 CAGGGTCTGGAATGCTGGAATGG - Intergenic
991690670 5:69222241-69222263 CAGACTTTGGAATTTGGGAAAGG + Intronic
992215624 5:74522314-74522336 TAGGATTTGGAAAATGGGAAAGG + Intergenic
992399365 5:76397605-76397627 CAGGATCTCGATTTTGGGATTGG - Intergenic
992959061 5:81940462-81940484 CAGGATTAGGATTATGGGAGGGG + Intergenic
993706901 5:91181431-91181453 GAGGGTCAGGAATCTGGGAATGG + Intergenic
993799980 5:92320332-92320354 AAGGACCTGAAATTTGGGAAAGG + Intergenic
994969062 5:106712667-106712689 CAAGAGTTGGAAAATGGGAAGGG - Intergenic
995217941 5:109616477-109616499 CAGGATATGGGATGTGGGAGGGG - Intergenic
995282840 5:110355149-110355171 CTGGATCTGGAATGGGAGAAGGG - Intronic
995398940 5:111718942-111718964 TAGGAGATAGAATATGGGAAAGG - Intronic
996439420 5:123472747-123472769 CAGGATCTAGGATATGGCCATGG - Intergenic
996846450 5:127904185-127904207 CAGCCTCTGGAAAATGGGAAAGG + Intergenic
997036505 5:130198980-130199002 TTGGGTCAGGAATATGGGAAGGG + Intergenic
997906268 5:137820597-137820619 CAGGGTCTGGCATATAGAAAGGG + Intergenic
998949617 5:147379759-147379781 CGGCATCTGAAATATTGGAAGGG - Intronic
999703390 5:154249143-154249165 CAGGAACTGCATTATGTGAAAGG - Intronic
999728717 5:154459214-154459236 CAGGATCTCAAAGTTGGGAAAGG + Exonic
999990735 5:157047655-157047677 CAGGATGAGGTATATGGGAAAGG - Intronic
1000082134 5:157858660-157858682 CAGGGGTTGGAATAGGGGAAGGG + Intronic
1000096091 5:157972007-157972029 GAGGGTCAGGAATCTGGGAATGG + Intergenic
1003321169 6:5053322-5053344 CAGGATCCAGAAAATGGAAATGG + Intergenic
1003493383 6:6642759-6642781 CCAGATCTGGAAGATGGGGAAGG - Intronic
1003554069 6:7124385-7124407 CAGGAAGTGGAATTTTGGAAGGG + Intronic
1003629468 6:7773476-7773498 CAAGATCAGAAATAGGGGAAGGG + Intronic
1004590919 6:17050778-17050800 TAGGGTCAGGCATATGGGAAGGG - Intergenic
1005178530 6:23076016-23076038 AAGGATCTGGAGAAAGGGAAAGG + Intergenic
1005309366 6:24544692-24544714 CAGGCCCTAGAATATGGGAGTGG - Exonic
1006105492 6:31713822-31713844 CAGGCTCAGGAATCTGGGAGAGG + Exonic
1006255778 6:32830801-32830823 CAGGGTCTGGAAAACAGGAATGG + Exonic
1007132707 6:39491436-39491458 CTGGATCAGGAGTTTGGGAAGGG - Intronic
1007655601 6:43449405-43449427 CAGGATCTGGAATATGGGAATGG - Exonic
1007918829 6:45587497-45587519 CAGGATCTGGCAGATGGTATTGG - Intronic
1011335879 6:86259273-86259295 TAGGAGCTGGAATCTGGGCAGGG + Intergenic
1011821681 6:91260596-91260618 TAGGATAAGGAATATGGAAAGGG - Intergenic
1012677608 6:102137091-102137113 AAGGATATGAAATTTGGGAAGGG - Intergenic
1012965194 6:105666448-105666470 CAGGATCTGGAACGTAGAAAAGG + Intergenic
1015076290 6:129162386-129162408 CAGAGTATGGAAAATGGGAAAGG - Intronic
1015281708 6:131441676-131441698 CAGCATCTGGCATCTGGCAAGGG - Intergenic
1015647052 6:135403814-135403836 CAGGATATGGAATATAGACAAGG - Intronic
1017653191 6:156601656-156601678 CAAGATCTGGAATATGGATGTGG + Intergenic
1018793129 6:167165115-167165137 GAGGATGTGGAATATGATAAAGG + Intronic
1020719393 7:11722275-11722297 CAAGATTAGGATTATGGGAAGGG + Intronic
1021399535 7:20193986-20194008 CAAGATCTGGAATTTAGGTAAGG + Intronic
1021466522 7:20950324-20950346 GAGGAACTGGAAGATGGGAATGG - Intergenic
1021813384 7:24424894-24424916 CAGGAGATGGAAAAAGGGAATGG + Intergenic
1022012189 7:26317994-26318016 CGGCATCTAGGATATGGGAAAGG + Intronic
1022850013 7:34250631-34250653 CATTATCTGGAAAATGGTAAAGG + Intergenic
1023463553 7:40427759-40427781 CAGGATATGACATCTGGGAAGGG + Intronic
1024035454 7:45504232-45504254 CAAGATCAGGATTATGGGAGGGG + Intergenic
1024041496 7:45559467-45559489 CAGGATTAGGATTATGGGAGGGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1025844598 7:65185006-65185028 CAGTCACTGGAAAATGGGAATGG + Intergenic
1025894926 7:65691344-65691366 CAGTCACTGGAAAATGGGAATGG + Intergenic
1026452131 7:70538761-70538783 TATGAAATGGAATATGGGAAAGG - Intronic
1026628616 7:72018383-72018405 TAGGATATGGTATATGGGAATGG - Intronic
1028499683 7:91505356-91505378 CAGGGTCTGGAACATGGAAGAGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1033589715 7:142798875-142798897 CAGGATCTGAAGTGTGGAAATGG + Intergenic
1034046788 7:147937645-147937667 CAGGATCTGAAACATGGGGGTGG - Intronic
1034734572 7:153416552-153416574 CTGGATCCTGAATATTGGAATGG - Intergenic
1035789354 8:2289606-2289628 CAAGATCAGGATTATGGGAGGGG + Intergenic
1035803451 8:2432099-2432121 CAAGATCAGGATTATGGGAGGGG - Intergenic
1035986217 8:4434770-4434792 CAGGGTCTGGAGTGTGGAAAGGG - Intronic
1036534527 8:9633939-9633961 GAGGGTCAGGAATCTGGGAATGG - Intronic
1038275430 8:26117115-26117137 GAGGATCAGGAATTTGGGCAAGG - Intergenic
1038428747 8:27482987-27483009 GAGGAACAGGAATATTGGAATGG - Intergenic
1039305230 8:36254781-36254803 CAGGATAAGGATTATGGGAGGGG + Intergenic
1039389670 8:37167926-37167948 CAGTATTTGGAATATGAAAACGG + Intergenic
1039659487 8:39447324-39447346 GAGGAGCTGGAAGAGGGGAACGG - Intergenic
1041366649 8:57113506-57113528 CCTAATCTGGAATATGGGAGTGG + Intergenic
1041370097 8:57150079-57150101 GTGGCTGTGGAATATGGGAAAGG + Intergenic
1042281956 8:67064674-67064696 CAGGCTCTGGAATCTGGGGGTGG + Intronic
1043919108 8:85960946-85960968 CAAGATCAGGAATATGTTAATGG + Intergenic
1043992867 8:86777706-86777728 CAGTGCCTGGAATATAGGAAGGG + Intergenic
1048075827 8:131069929-131069951 CAGGACCTGGAAAGTGGGATAGG + Intergenic
1048389609 8:133949249-133949271 TAAGATCTGGAATAAGGCAAGGG + Intergenic
1048987753 8:139744364-139744386 CAGGGTCTGGAAGCGGGGAAGGG - Intronic
1053062475 9:35043126-35043148 CAGAATCTGGAAGATGGGGAAGG - Exonic
1053144161 9:35700728-35700750 AATGTTCTGGAATATAGGAATGG + Intronic
1053767435 9:41421474-41421496 TAAGATCTGTAACATGGGAAAGG + Intergenic
1054319443 9:63640260-63640282 TAAGATCTGTAACATGGGAAAGG - Intergenic
1056341599 9:85639561-85639583 CAGGATTTAGCATGTGGGAAAGG + Intronic
1056557669 9:87703270-87703292 CAAGAGCTGGAATTTGGGACAGG - Intronic
1057210097 9:93196354-93196376 CAGAATCTGGAATCTGGAGATGG + Intronic
1057843946 9:98507431-98507453 CAGCATCTAGAAGGTGGGAAAGG + Intronic
1057891724 9:98874796-98874818 CAGGAGCTGGAAGAGGAGAAAGG - Intergenic
1059166600 9:112082549-112082571 CAGGATCTAGAAACTGGAAAGGG + Intronic
1059367005 9:113794200-113794222 CAGGACCCGGAACATGGGTATGG + Intergenic
1060256689 9:122036963-122036985 CGGCATGTGGAATATGGGATGGG + Intronic
1060696707 9:125715164-125715186 CAGGACCTGGATTTTGGAAAGGG - Intergenic
1060826744 9:126692093-126692115 CAGGATCTGCCACATGGGAAGGG + Intronic
1061360060 9:130135700-130135722 CAGCATCTGGAATAAGGGTCTGG - Exonic
1062163549 9:135093508-135093530 CAGTGCCTGGAACATGGGAAAGG + Intronic
1186840785 X:13483076-13483098 CAGGACATGGAAAATGAGAAGGG + Intergenic
1187747866 X:22429245-22429267 AAGAATATGGAATATGTGAAAGG - Intergenic
1188637008 X:32446051-32446073 CAGTAACTGGAATATAAGAAGGG + Intronic
1188988239 X:36787181-36787203 CTGGATGTGGAATGTGAGAAAGG + Intergenic
1189030415 X:37443592-37443614 CATGGTCTGGAATAAGGTAATGG - Intronic
1189261191 X:39679905-39679927 CAGGATCAGCAATTTGGGCAGGG + Intergenic
1189309744 X:40010908-40010930 CTGCAACTTGAATATGGGAATGG + Intergenic
1190469505 X:50764218-50764240 CAGGAGCTGGAGGATGGGGATGG + Intronic
1190712763 X:53081802-53081824 CAGGAGCTGGGATGGGGGAAGGG + Intergenic
1193167911 X:78302712-78302734 CAGGAACTGGGATCTGGAAAAGG + Intronic
1194114112 X:89874196-89874218 GAGGATCTCGAAGGTGGGAAAGG - Intergenic
1197192712 X:123666178-123666200 CGGGAACTTGGATATGGGAATGG + Intronic
1198513949 X:137385334-137385356 CAGGGCCTGGAGTATGGGGATGG + Intergenic
1199139573 X:144293972-144293994 CAGGATTTGGAATAAGGAGAAGG - Intergenic
1199172486 X:144747060-144747082 TAGCATCTGGTATATGGGGAAGG + Intergenic
1201602782 Y:15749117-15749139 ATGGAAATGGAATATGGGAAGGG + Intergenic
1201903879 Y:19069728-19069750 CAGCGTCTGGAACATGGAAAAGG + Intergenic