ID: 1007657110

View in Genome Browser
Species Human (GRCh38)
Location 6:43456972-43456994
Sequence CACCCACTCAGCTCCCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007657108_1007657110 6 Left 1007657108 6:43456943-43456965 CCTGCAGTCTCCATTGGATATAA No data
Right 1007657110 6:43456972-43456994 CACCCACTCAGCTCCCTAGCTGG No data
1007657104_1007657110 23 Left 1007657104 6:43456926-43456948 CCCCAGGGCTCATTTTTCCTGCA No data
Right 1007657110 6:43456972-43456994 CACCCACTCAGCTCCCTAGCTGG No data
1007657109_1007657110 -4 Left 1007657109 6:43456953-43456975 CCATTGGATATAACACTTACACC No data
Right 1007657110 6:43456972-43456994 CACCCACTCAGCTCCCTAGCTGG No data
1007657105_1007657110 22 Left 1007657105 6:43456927-43456949 CCCAGGGCTCATTTTTCCTGCAG No data
Right 1007657110 6:43456972-43456994 CACCCACTCAGCTCCCTAGCTGG No data
1007657106_1007657110 21 Left 1007657106 6:43456928-43456950 CCAGGGCTCATTTTTCCTGCAGT No data
Right 1007657110 6:43456972-43456994 CACCCACTCAGCTCCCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007657110 Original CRISPR CACCCACTCAGCTCCCTAGC TGG Intergenic
No off target data available for this crispr