ID: 1007661385

View in Genome Browser
Species Human (GRCh38)
Location 6:43488970-43488992
Sequence CTGATGACTCAGGGCAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007661385_1007661392 4 Left 1007661385 6:43488970-43488992 CCCTTTTTGCCCTGAGTCATCAG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1007661392 6:43488997-43489019 CCTGCAGGGCTTCCTAGAACAGG No data
1007661385_1007661390 -10 Left 1007661385 6:43488970-43488992 CCCTTTTTGCCCTGAGTCATCAG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1007661390 6:43488983-43489005 GAGTCATCAGAGAGCCTGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 233
1007661385_1007661393 11 Left 1007661385 6:43488970-43488992 CCCTTTTTGCCCTGAGTCATCAG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1007661393 6:43489004-43489026 GGCTTCCTAGAACAGGAGAGAGG 0: 1
1: 0
2: 3
3: 23
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007661385 Original CRISPR CTGATGACTCAGGGCAAAAA GGG (reversed) Intronic
902642995 1:17778723-17778745 CTCATCAGTTAGGGCAAAAAGGG - Intronic
905005574 1:34707032-34707054 CTGAAGACTTAGTACAAAAAAGG - Intergenic
905408308 1:37752496-37752518 CTGATTTCTCAGGGAAAAAGAGG - Intronic
908344864 1:63221964-63221986 TAAATGACTGAGGGCAAAAACGG + Intergenic
909831040 1:80190330-80190352 CTGAAAAGTCAGGGGAAAAAAGG + Intergenic
913438325 1:118870677-118870699 CTGAGGACTCAGGGAAATCAAGG - Intergenic
913476223 1:119240943-119240965 CTGAAGACTCAGGGAAAAGATGG - Intergenic
914451844 1:147799665-147799687 CTGATGATTAAGGGCAGACACGG + Intergenic
917610403 1:176683641-176683663 CTGGTGACCAAGGACAAAAATGG - Intronic
918524382 1:185449883-185449905 ATGATGATTCAGGTCAAACATGG + Intergenic
919894355 1:201999737-201999759 CTGGGGACCCAGGGCAAATAGGG - Intronic
921189485 1:212697114-212697136 GTGATGAGACAGGGCAGAAAAGG - Intronic
924745627 1:246831155-246831177 CTCAGGACCCAGGGCAAAAGTGG - Intergenic
924904978 1:248442436-248442458 CTGCTCAGTCATGGCAAAAACGG + Intergenic
1063846877 10:10139157-10139179 CAGATGAATCAAGGCAATAAAGG + Intergenic
1067735618 10:48848080-48848102 TGGATGACTCAGGCCAGAAAAGG - Intronic
1068054099 10:51989404-51989426 CGGATGAGGCAGGGCAAAATAGG + Intronic
1071348669 10:84717362-84717384 CTGATGACGCAGGGCTGAGAAGG - Intergenic
1072096731 10:92189025-92189047 CTCTTGATTCAGGGGAAAAAAGG - Intronic
1073280745 10:102352262-102352284 CTACTGAGTCAGGGAAAAAAGGG - Intronic
1074205625 10:111280607-111280629 CCTATGACTCAGGGCACAGAAGG - Intergenic
1076619050 10:131775438-131775460 CTGCTGACTCAGGCACAAAAGGG - Intergenic
1078251903 11:9623290-9623312 CTGCTGGCTCTGGGCAAAATGGG - Intergenic
1079292119 11:19197606-19197628 ATGATGAGTTAGGGCAAAAGTGG + Intronic
1079414494 11:20220969-20220991 CTGATGAATAAGGAGAAAAAGGG + Intergenic
1079730662 11:23935358-23935380 CTGCTGGATCAGGGCAAAGAAGG + Intergenic
1079855398 11:25596590-25596612 CTGATCACTTAGTGAAAAAATGG + Intergenic
1079994664 11:27282912-27282934 ATGATGACCCAGGGTCAAAAGGG + Intergenic
1082892508 11:58155133-58155155 CTGAAGACTCAGGGAAGAGATGG + Intronic
1083270034 11:61567617-61567639 GTCCTGACTCAGGACAAAAAGGG + Intronic
1083975489 11:66116295-66116317 CTAACGACTGAGGGCAAAGAAGG - Intronic
1085197641 11:74682117-74682139 CTGCAGACACAGGGCAAATAGGG + Intergenic
1088758518 11:112907331-112907353 TTGATGATTCAGTGCAAATAAGG + Intergenic
1089076179 11:115740691-115740713 TTGATGGCTCAGAGCAAAATGGG + Intergenic
1089693799 11:120203836-120203858 CTGATGGCTCTGGTCAGAAATGG + Intergenic
1089771339 11:120805451-120805473 CAGATGAATCAGGGGAATAAAGG + Intronic
1091281067 11:134381966-134381988 CTGGTGAATGAGGGCAAGAAGGG - Exonic
1092632754 12:10401049-10401071 CTGATTGCTAGGGGCAAAAAGGG + Intronic
1093518657 12:20021564-20021586 CTGAAGACTCAGGGAAAAGGTGG + Intergenic
1096450813 12:51739604-51739626 CGGATGCCTCAGGGTAACAATGG - Intronic
1097958944 12:65513815-65513837 CTGATGTCTCAAAACAAAAATGG + Intergenic
1098181864 12:67855810-67855832 CTGAGGACACAGGGTAAACAAGG - Intergenic
1098759614 12:74406749-74406771 CTGATTGCTCAGGGAAAATAGGG + Intergenic
1103308709 12:119988516-119988538 CTGATGACTCAGGGATATGAAGG - Intergenic
1104963708 12:132499770-132499792 CTGGGGACTCAGGGCAAATGGGG + Intronic
1107293429 13:38883587-38883609 ATGTTAACTAAGGGCAAAAATGG - Exonic
1112046165 13:95600388-95600410 GTGATGAGCCAGGGTAAAAATGG + Intronic
1113882231 13:113633722-113633744 CAGATGACGCAGGGCAAGACGGG - Intronic
1117851428 14:59975279-59975301 ATGATGATTCAGGACAAATAAGG - Intronic
1119084347 14:71726256-71726278 CTCATCATTCAGGGCACAAATGG + Intronic
1119116611 14:72027739-72027761 GTAATGACTAAGGGAAAAAATGG - Intronic
1120920313 14:89749071-89749093 CTGGTGACTCAGGGCTCCAAAGG + Intergenic
1122478284 14:102027655-102027677 TTGATGACGCAGTGCAAAGAGGG + Exonic
1124533204 15:30523650-30523672 CTGAGGAAACAGGCCAAAAAGGG + Intergenic
1125067518 15:35507024-35507046 AAGATGACTAAGTGCAAAAAAGG - Intronic
1125492678 15:40159963-40159985 CTGATGATTCAGAGGAAAGAAGG + Intergenic
1125543464 15:40486303-40486325 ATGAAGATTCAGGGAAAAAAGGG + Intergenic
1128216703 15:65939278-65939300 AGGATGACTCAAGGCAAGAATGG + Intronic
1129440110 15:75575293-75575315 CTGTTCACACAGGCCAAAAAGGG + Intronic
1130754123 15:86744692-86744714 CTCAGGACTCAGTGCAAAGAGGG - Intronic
1132162931 15:99559992-99560014 CTGATTACTAAAGGCAAAATGGG - Intergenic
1133829628 16:9309807-9309829 CTGATGCCTCTGGGCAGTAAAGG + Intergenic
1134325977 16:13208263-13208285 CTGCCAACTCAGGGAAAAAACGG + Intronic
1137780615 16:51095121-51095143 CTGATGCCTCCGAGCAAGAAGGG - Intergenic
1138120779 16:54399441-54399463 ATGAGGACTGAGGCCAAAAAGGG + Intergenic
1144843823 17:18205455-18205477 CTGATGCCTCAGGCCCAAACTGG - Intronic
1145016003 17:19398589-19398611 CTGATGACCCAGTGCCAAAGAGG - Intergenic
1148948179 17:51283926-51283948 TTGATGACTTATGGCAAAAAAGG - Intronic
1155174229 18:23288830-23288852 CTGAAGACTCAGGACCATAAGGG - Intronic
1157022627 18:43805202-43805224 TTTCTGACCCAGGGCAAAAATGG + Intergenic
1159135077 18:64327976-64327998 CTGAAATCTCAGGGGAAAAAAGG - Intergenic
1167874533 19:52400467-52400489 CTGGTGACTCAGATAAAAAAAGG - Intronic
928016841 2:27665077-27665099 CTGATGAACCAAGGAAAAAAAGG - Intronic
935204755 2:100888026-100888048 CTGCAGACTAAGGGCAAAAAGGG - Intronic
935232388 2:101110221-101110243 CTACTGATTCAGGGCAAACAGGG + Intronic
937631692 2:124109196-124109218 CTGATGTCCCAGGGGAAAAAGGG + Intronic
938637546 2:133245854-133245876 TTTATAACTCAGAGCAAAAAAGG + Intronic
939083873 2:137694072-137694094 CTGGTGACTCAGGACAATTATGG + Intergenic
940568215 2:155396388-155396410 GTGATGACTCAGGCATAAAATGG + Intergenic
942624163 2:177881508-177881530 CTGATGACTCAGGGTCAATTTGG - Intronic
1170237837 20:14127411-14127433 CTGTTGTCTCTTGGCAAAAATGG + Intronic
1170836309 20:19887677-19887699 CTGATGAGCCAGGGCAGACAGGG - Intronic
1173046758 20:39520127-39520149 CTCATGACTCCAGGCAAATACGG - Intergenic
1173539285 20:43839038-43839060 CTGATCACTCAGGGAAGAACTGG - Intergenic
1173951139 20:46994310-46994332 CTTATGATTCAAGGGAAAAATGG + Intronic
1175312184 20:58019674-58019696 CTCATGCCTGAGGGCAAAAGGGG - Intergenic
1175422336 20:58842141-58842163 CTGATGACCCAGCACAAAAACGG + Intronic
1177598029 21:23271492-23271514 TTAATGACTCAGGCCAAATATGG + Intergenic
1178548788 21:33517266-33517288 CTGATTACTTAGAGCTAAAAGGG - Intronic
1181676288 22:24455543-24455565 CAGAGGAGTCAGGGCAAGAAAGG - Intergenic
1183602455 22:38847876-38847898 CCAATGACTCAGGGTGAAAAGGG - Intergenic
950153586 3:10707048-10707070 CTGAGGCCTCAGGGCAAGGAGGG + Intronic
950638002 3:14329634-14329656 CTGCTGACTCAGAGGAACAAGGG + Intergenic
950934387 3:16823904-16823926 CTGACAGCTCAGGGCAGAAAGGG + Intronic
952018627 3:28989920-28989942 CTGATGACTCAGGGCAGGAAAGG - Intergenic
952148655 3:30562319-30562341 CTGATGACTGAGTGCCAGAAGGG - Intergenic
954110751 3:48431489-48431511 CTGTTTACTCAGGGCACACAAGG + Intergenic
957391341 3:79575875-79575897 ATGATGCTTCAGGGCAAACAAGG - Intronic
960418392 3:117413310-117413332 ATAATGACTCTGGGCAGAAAAGG + Intergenic
960882539 3:122360015-122360037 CTGTTGACTTAGGACAAAAATGG - Intronic
962664865 3:137643797-137643819 CTGATTATTCAGGTCTAAAAGGG - Intergenic
964558227 3:157964336-157964358 CTGATGAGGCAGGCCAGAAAAGG - Intergenic
965554750 3:170007414-170007436 CTGAAGACACATGGAAAAAATGG + Intergenic
967464331 3:189785877-189785899 ATGCTGAATGAGGGCAAAAAAGG - Intronic
969370592 4:6728761-6728783 CTGAGGACACAGGGCAAGCAGGG - Intergenic
972590025 4:40476853-40476875 GTGATGACTCAGGGAAAACTGGG - Intronic
975927582 4:79477032-79477054 CTTTTGTCTCAGGGGAAAAATGG + Intergenic
976430134 4:84953423-84953445 CTTTTGACACAGGGGAAAAATGG + Intronic
976517803 4:85990862-85990884 GTGAAGACTCAGGACACAAAAGG + Intronic
980101458 4:128545309-128545331 CTGATTACTCTGGGGAAAAGAGG - Intergenic
980501741 4:133664534-133664556 GTGATGACTCAGGGAAAGATTGG - Intergenic
983444526 4:167833091-167833113 CTGATGCTTCTGGGCAAAAGTGG - Intergenic
983858966 4:172680576-172680598 CAGATGACAAATGGCAAAAAAGG - Intronic
987895438 5:23940360-23940382 CTGATGAATCAAGGCAAAAGGGG - Intergenic
989558891 5:42828529-42828551 ATTCTGACTCAGTGCAAAAATGG - Intronic
990152067 5:52829900-52829922 CTGAGGATTCAAGGCATAAAAGG + Intronic
990472153 5:56125667-56125689 CTTTTAACTCAGGGAAAAAATGG - Intronic
990528439 5:56651197-56651219 CTGATGTCTGAGGGCAAAGATGG - Intergenic
990879417 5:60522735-60522757 CTGATGATTCAGACCAGAAATGG - Intergenic
992263432 5:74993206-74993228 CTGATGACCCTGGGCAAGACAGG - Intergenic
993645853 5:90460814-90460836 TTGATGACCTAGGGAAAAAAAGG - Exonic
993938375 5:94030108-94030130 CTGATGACACATGGGAATAACGG + Intronic
997525215 5:134548700-134548722 CTGAGAACTCAGGGCAGGAAGGG - Intronic
998183958 5:139964829-139964851 CTGATGGCTCAGGGCTAGATAGG - Intronic
999048453 5:148495394-148495416 CAGATAACTGAGGGCAGAAAAGG - Intronic
1000677710 5:164141982-164142004 CTGATGACACAGGATGAAAATGG - Intergenic
1000910475 5:167015899-167015921 AGGATTACTCAGGGCAGAAAAGG - Intergenic
1001040604 5:168332230-168332252 CTGATGACTCAGAGCTGAGAAGG + Intronic
1004277675 6:14252884-14252906 CTGGTGTCTCAGGGACAAAACGG + Intergenic
1005269370 6:24146965-24146987 TCGATGACACATGGCAAAAATGG - Exonic
1006717024 6:36127128-36127150 CTGATGACTCGTTGCAACAAGGG - Intergenic
1007505442 6:42331916-42331938 CTGATTTTTCAGGGCAAGAATGG - Intronic
1007661385 6:43488970-43488992 CTGATGACTCAGGGCAAAAAGGG - Intronic
1008081521 6:47199612-47199634 CTGAAGACTGGGGGCAAGAAGGG + Intergenic
1009826444 6:68871321-68871343 CAGATGACTGAGGGGAAATAGGG + Intronic
1012538890 6:100336545-100336567 TTTTTCACTCAGGGCAAAAAAGG - Intergenic
1012611146 6:101222589-101222611 CTGGTTACTCAGTACAAAAATGG - Intergenic
1013368498 6:109451883-109451905 CTGAGGACTTAGAGCAAAGAGGG + Intronic
1017347292 6:153398820-153398842 CTGAAGACACTGGGCTAAAATGG - Intergenic
1018963115 6:168462714-168462736 CAGAGGACTCAGGGAGAAAAAGG + Intronic
1021126588 7:16857821-16857843 TTGATGAGTCAGAGAAAAAAAGG - Intergenic
1022248899 7:28587406-28587428 CTGATGACTCACAGCATCAATGG - Intronic
1022763530 7:33383106-33383128 CTGAGGTCTCAGGGAATAAAGGG + Intronic
1023107427 7:36775912-36775934 CTTATTACTCATGGCAAAAAGGG - Intergenic
1023951994 7:44853604-44853626 CTGATGACTAAGGGCAAGGATGG - Intergenic
1026164344 7:67896708-67896730 GGGAAGACTCAGGTCAAAAAGGG - Intergenic
1029872199 7:103706725-103706747 CTCATGACTCAAGGCCATAATGG + Intronic
1029924257 7:104298837-104298859 CAGATTACTCAGAGCAAAGATGG + Intergenic
1030716379 7:112812614-112812636 CTGAAGACACAGGACAGAAAAGG + Intergenic
1032728765 7:134616793-134616815 CTGATGATGCAGGGAAAAGAAGG + Intergenic
1033348907 7:140546035-140546057 CTGAAGACTCAAGGCTAAATGGG + Intronic
1040128720 8:43769155-43769177 TTGAGGACTAAGGGGAAAAATGG + Intergenic
1041257115 8:55988828-55988850 CAGATGACTGAGGGAAAAAAGGG - Intronic
1043521070 8:81046017-81046039 CTGATGACACAGAGAAAAAGAGG - Intronic
1044122583 8:88415826-88415848 CTGATTAGTCAGGCCAACAAAGG + Intergenic
1046478408 8:114780416-114780438 CTGATTAATCTGGGCAAAATAGG + Intergenic
1048822944 8:138396439-138396461 CCAATGACTCAGGGCAAGAGTGG + Intronic
1050308662 9:4331022-4331044 CAGATGGCTCAGGGCAAGATGGG - Intronic
1056421913 9:86436731-86436753 CAGGTGATTCAGGTCAAAAAAGG - Intergenic
1057966566 9:99509610-99509632 ATGATAACTCAGCGCCAAAAAGG + Intergenic
1060229177 9:121814372-121814394 CTGATCACACAGGGCAAAACAGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060791077 9:126486193-126486215 TTGATAACTCAGGGAAAAAATGG + Intronic
1061873738 9:133533994-133534016 CTGCTGAGTCAGGGCACAGAGGG - Intronic
1186691115 X:11976844-11976866 CTGATGAGTCATGGCAAATAAGG - Intergenic
1186838196 X:13458893-13458915 TTGAAGACTTAGTGCAAAAAAGG - Intergenic
1187430080 X:19214580-19214602 CTGATGACTAAGAGCAAGCAGGG - Intergenic
1190888663 X:54550926-54550948 CAGATGGCTCAGGGCAGAAGAGG - Intronic
1196566742 X:117215389-117215411 CGGATGACTCAAGGCAAAGGTGG + Intergenic
1196692373 X:118574158-118574180 CTGAAGTTTGAGGGCAAAAATGG + Intronic