ID: 1007662182

View in Genome Browser
Species Human (GRCh38)
Location 6:43493606-43493628
Sequence GAGATGCAGAAGAGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1044
Summary {0: 1, 1: 0, 2: 10, 3: 107, 4: 926}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007662182_1007662189 18 Left 1007662182 6:43493606-43493628 CCTCCTTTCCTCTTCTGCATCTC 0: 1
1: 0
2: 10
3: 107
4: 926
Right 1007662189 6:43493647-43493669 AGGCAGAACCCCGGAAAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 249
1007662182_1007662185 -2 Left 1007662182 6:43493606-43493628 CCTCCTTTCCTCTTCTGCATCTC 0: 1
1: 0
2: 10
3: 107
4: 926
Right 1007662185 6:43493627-43493649 TCTGACTTTGCCTGAGCTTTAGG No data
1007662182_1007662190 25 Left 1007662182 6:43493606-43493628 CCTCCTTTCCTCTTCTGCATCTC 0: 1
1: 0
2: 10
3: 107
4: 926
Right 1007662190 6:43493654-43493676 ACCCCGGAAAGGATGGCAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 165
1007662182_1007662192 26 Left 1007662182 6:43493606-43493628 CCTCCTTTCCTCTTCTGCATCTC 0: 1
1: 0
2: 10
3: 107
4: 926
Right 1007662192 6:43493655-43493677 CCCCGGAAAGGATGGCAGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 150
1007662182_1007662188 14 Left 1007662182 6:43493606-43493628 CCTCCTTTCCTCTTCTGCATCTC 0: 1
1: 0
2: 10
3: 107
4: 926
Right 1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1007662182_1007662187 9 Left 1007662182 6:43493606-43493628 CCTCCTTTCCTCTTCTGCATCTC 0: 1
1: 0
2: 10
3: 107
4: 926
Right 1007662187 6:43493638-43493660 CTGAGCTTTAGGCAGAACCCCGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007662182 Original CRISPR GAGATGCAGAAGAGGAAAGG AGG (reversed) Intronic