ID: 1007662183

View in Genome Browser
Species Human (GRCh38)
Location 6:43493609-43493631
Sequence TCAGAGATGCAGAAGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007662183_1007662189 15 Left 1007662183 6:43493609-43493631 CCTTTCCTCTTCTGCATCTCTGA No data
Right 1007662189 6:43493647-43493669 AGGCAGAACCCCGGAAAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 249
1007662183_1007662190 22 Left 1007662183 6:43493609-43493631 CCTTTCCTCTTCTGCATCTCTGA No data
Right 1007662190 6:43493654-43493676 ACCCCGGAAAGGATGGCAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 165
1007662183_1007662188 11 Left 1007662183 6:43493609-43493631 CCTTTCCTCTTCTGCATCTCTGA No data
Right 1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1007662183_1007662192 23 Left 1007662183 6:43493609-43493631 CCTTTCCTCTTCTGCATCTCTGA No data
Right 1007662192 6:43493655-43493677 CCCCGGAAAGGATGGCAGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 150
1007662183_1007662195 29 Left 1007662183 6:43493609-43493631 CCTTTCCTCTTCTGCATCTCTGA No data
Right 1007662195 6:43493661-43493683 AAAGGATGGCAGAAGGGAAGTGG No data
1007662183_1007662196 30 Left 1007662183 6:43493609-43493631 CCTTTCCTCTTCTGCATCTCTGA No data
Right 1007662196 6:43493662-43493684 AAGGATGGCAGAAGGGAAGTGGG 0: 1
1: 0
2: 4
3: 150
4: 2541
1007662183_1007662187 6 Left 1007662183 6:43493609-43493631 CCTTTCCTCTTCTGCATCTCTGA No data
Right 1007662187 6:43493638-43493660 CTGAGCTTTAGGCAGAACCCCGG 0: 1
1: 0
2: 0
3: 11
4: 148
1007662183_1007662185 -5 Left 1007662183 6:43493609-43493631 CCTTTCCTCTTCTGCATCTCTGA No data
Right 1007662185 6:43493627-43493649 TCTGACTTTGCCTGAGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007662183 Original CRISPR TCAGAGATGCAGAAGAGGAA AGG (reversed) Intronic