ID: 1007662184

View in Genome Browser
Species Human (GRCh38)
Location 6:43493614-43493636
Sequence CAAAGTCAGAGATGCAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 447}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007662184_1007662187 1 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662187 6:43493638-43493660 CTGAGCTTTAGGCAGAACCCCGG 0: 1
1: 0
2: 0
3: 11
4: 148
1007662184_1007662190 17 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662190 6:43493654-43493676 ACCCCGGAAAGGATGGCAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 165
1007662184_1007662188 6 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1007662184_1007662195 24 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662195 6:43493661-43493683 AAAGGATGGCAGAAGGGAAGTGG No data
1007662184_1007662197 29 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662197 6:43493666-43493688 ATGGCAGAAGGGAAGTGGGACGG 0: 1
1: 0
2: 9
3: 140
4: 1078
1007662184_1007662185 -10 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662185 6:43493627-43493649 TCTGACTTTGCCTGAGCTTTAGG No data
1007662184_1007662189 10 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662189 6:43493647-43493669 AGGCAGAACCCCGGAAAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 249
1007662184_1007662192 18 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662192 6:43493655-43493677 CCCCGGAAAGGATGGCAGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 150
1007662184_1007662196 25 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662196 6:43493662-43493684 AAGGATGGCAGAAGGGAAGTGGG 0: 1
1: 0
2: 4
3: 150
4: 2541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007662184 Original CRISPR CAAAGTCAGAGATGCAGAAG AGG (reversed) Intronic