ID: 1007662188

View in Genome Browser
Species Human (GRCh38)
Location 6:43493643-43493665
Sequence CTTTAGGCAGAACCCCGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007662182_1007662188 14 Left 1007662182 6:43493606-43493628 CCTCCTTTCCTCTTCTGCATCTC 0: 1
1: 0
2: 10
3: 107
4: 926
Right 1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1007662183_1007662188 11 Left 1007662183 6:43493609-43493631 CCTTTCCTCTTCTGCATCTCTGA 0: 1
1: 0
2: 5
3: 80
4: 612
Right 1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1007662184_1007662188 6 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007662188 Original CRISPR CTTTAGGCAGAACCCCGGAA AGG Intronic
900933974 1:5753847-5753869 CCTTAGGCACAACCCCGGTAAGG + Intergenic
908095811 1:60737186-60737208 CTTTAGGAAGAACACATGAATGG - Intergenic
908549067 1:65191319-65191341 CTTTAGGCAGAAATCCAGAATGG - Intronic
912668028 1:111600521-111600543 CTTCAGGCAGAACGCTGGAGAGG - Intronic
920601833 1:207333339-207333361 TTTCAGTCAGAAGCCCGGAAGGG + Intronic
922382352 1:225043571-225043593 CTTTAATCAGAACCTTGGAATGG + Intronic
923065031 1:230509739-230509761 TTTCAGGCTGAACCCTGGAAGGG + Intergenic
1066529782 10:36324716-36324738 CATTAGGCAGAGTCCTGGAAAGG - Intergenic
1071322559 10:84478147-84478169 TTTTAGGCAGAACTAGGGAATGG + Intronic
1075237220 10:120741699-120741721 CTTTATGCACAGCCCCTGAAGGG - Intergenic
1076891009 10:133283417-133283439 CTTAAGGCAGAAGACAGGAAGGG + Intronic
1079075634 11:17383985-17384007 CTTAAGGCATAACCCAGGGAGGG - Intergenic
1082147845 11:48692529-48692551 CTTTTGGCAGAATCCATGAAGGG + Intergenic
1082582242 11:54886180-54886202 ATTTTGGCAGAATCCAGGAAGGG + Intergenic
1082588514 11:54974436-54974458 GTTTTGGCAGAATCCAGGAAGGG + Intergenic
1082588788 11:54978739-54978761 ATTTTGGCAGAATCCGGGAAAGG + Intergenic
1082590756 11:55006257-55006279 GTTTTGGCAGAATCCCCGAAGGG - Intergenic
1082592702 11:55033086-55033108 CTTTTGGCAGAATCCATGAAGGG - Intergenic
1086357930 11:86024973-86024995 CTTTAGGGAGAACCTCATAAAGG - Intronic
1090523492 11:127504179-127504201 CTTTAGGGAAAATCCTGGAAGGG + Intergenic
1091613630 12:2032624-2032646 TTTTATGCAGAACCCGTGAAAGG + Intronic
1099707895 12:86180370-86180392 CATTAGGCAGTGCCCCAGAAAGG - Intronic
1100581269 12:95942761-95942783 CTGGAGGCAGAGCCCCGGGAGGG - Exonic
1101202875 12:102455065-102455087 CTTTAATCAAAACCCAGGAATGG - Intronic
1104543111 12:129685621-129685643 CTTTAGGCAGTACCCCAGTGGGG - Intronic
1104714042 12:131005030-131005052 CCTAAGGCAGAACCCTGGGAAGG - Intronic
1108463528 13:50692039-50692061 CTTTACTCAGAACCCTTGAATGG + Intronic
1113351704 13:109535855-109535877 CTTTAATCAGAACCCCGCAGAGG - Intergenic
1114756067 14:25261391-25261413 CTTTAGGTAGTACTCAGGAACGG + Intergenic
1115933744 14:38528157-38528179 CTAGAGGCAGAACCCATGAAAGG - Intergenic
1116785937 14:49288843-49288865 CTCTAGGCATAGCCCCTGAATGG + Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1119663161 14:76465726-76465748 CTTCAGGCAGAACTCCTTAAAGG - Intronic
1119802015 14:77454131-77454153 CTTTAGGGAGAGACCCAGAAAGG - Intronic
1120228938 14:81821971-81821993 CTTTAGGCAGAAAACAGGGAGGG + Intergenic
1122362498 14:101175711-101175733 CTTCAGGCAGAAGCCCTTAAAGG + Intergenic
1122710886 14:103656965-103656987 CTGTAGGCAGAGCCCTGGAGTGG + Intronic
1202849008 14_GL000225v1_random:4404-4426 CTTTAGGCAGAACCTAGACAAGG + Intergenic
1124379713 15:29155311-29155333 CGTTAGGCAGAACCAAGGCAAGG + Intronic
1125604252 15:40931100-40931122 CTGGAGGCAGAACCCCTGAATGG + Intronic
1131505238 15:93012023-93012045 CTTTTGGCAGAACCATGTAAAGG + Intronic
1135951593 16:26919336-26919358 ATTCATGCAGAACCCAGGAATGG - Intergenic
1138061837 16:53899623-53899645 CTTCAGACAGATCCCAGGAAAGG + Intronic
1139504872 16:67393752-67393774 CTTTAGGCACATCCCAGGATGGG - Intergenic
1145264632 17:21373916-21373938 CTTCACGCAGCACCCCGGGAGGG + Intergenic
1150122501 17:62615910-62615932 CTTAAGGCAGAATCACAGAAGGG + Intergenic
1152883287 17:82832724-82832746 CCTGAAGCAGAACCCCTGAAGGG + Intronic
1154381150 18:13851237-13851259 CTTTTGGCAGAGCACAGGAAAGG + Intergenic
1158437812 18:57446177-57446199 CTTTAGTCAAAACTCTGGAAAGG - Intronic
1159575436 18:70170484-70170506 ATTTAAGTAGAACCCTGGAAGGG + Intronic
1164989135 19:32672145-32672167 GTTTGGTCAGAGCCCCGGAAGGG - Intronic
1165060375 19:33202271-33202293 CTTTACGCAGAACCCCTCAGTGG - Intronic
1165520749 19:36311998-36312020 CTTGAGGCAAACTCCCGGAATGG + Intergenic
1165623323 19:37266587-37266609 CTTGAGGCAAACTCCCGGAATGG - Intergenic
1167902848 19:52635106-52635128 CATGAGGAAGAAACCCGGAAGGG - Exonic
1168279262 19:55295568-55295590 CTCCAGGAAGAACCCCAGAAAGG + Intronic
931145081 2:59508324-59508346 CATTAGGCAGTACCCCAGTAGGG - Intergenic
939815384 2:146889877-146889899 CCTTAGGTAGTACCCCAGAAAGG - Intergenic
944416566 2:199485125-199485147 CTTTAGGCAGAGCCCAGCAGAGG - Intergenic
947531563 2:230911915-230911937 CTTGATGCAGAACCCCACAATGG - Intronic
948436032 2:237955353-237955375 CTTTAGGCAGAACACAAAAAAGG - Intergenic
948804035 2:240445476-240445498 CTATAGGCAGAACCACGCCAGGG + Intronic
1169131024 20:3166487-3166509 CATGAGGTAGAACCCCGGATGGG - Intronic
1169583922 20:7058854-7058876 CATTAGGCAGTACCCCAGCAGGG + Intergenic
1170574548 20:17652615-17652637 CTGTAGGCAGAACTCCGGGTGGG - Intronic
1178974353 21:37208822-37208844 GTTTAGACAGAAGCCAGGAACGG + Intergenic
1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG + Intronic
1180702053 22:17786604-17786626 CTTTAGGGAGGACACCAGAAAGG - Intergenic
1180968447 22:19802535-19802557 CTTTGGGCAGAACCCAGGGTGGG - Intronic
1181328850 22:22073830-22073852 CTTCAGGCAGGACCCTGGAAGGG - Intergenic
955301692 3:57786259-57786281 CTTCAGCCTGAACCCCTGAAAGG - Intronic
955804732 3:62722328-62722350 CTTCAGACAGGATCCCGGAAGGG + Intronic
957493287 3:80957697-80957719 CTTTAGGCAGAATCAATGAAGGG - Intergenic
958041222 3:88229031-88229053 CTTTAGGCAGAATCCTATAAAGG - Intergenic
962414954 3:135173518-135173540 CTTGAGGAAGAACCCAGGACAGG - Intronic
963045982 3:141103041-141103063 CTTTATGCAGCACCCAGGACAGG - Intronic
972099660 4:35398132-35398154 CTTTATTCTGAACCCCTGAAGGG - Intergenic
974897624 4:67958185-67958207 CATTAGGCAGCACCCCAGTAGGG - Intronic
977623768 4:99167110-99167132 TTTTAAGCAGAACCCAGCAATGG + Intergenic
994510135 5:100692269-100692291 CTTTAGCCAGGACCATGGAATGG - Intergenic
998643770 5:144040688-144040710 CTCTGGGTAGAACCCTGGAAGGG + Intergenic
999293364 5:150442044-150442066 TTTCAGGCAAAACCCCCGAAAGG + Intergenic
1001684892 5:173585981-173586003 CATTAGGCAGAGCCCCAGTAGGG + Intergenic
1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG + Intronic
1007825226 6:44595042-44595064 CTTTAGTCAGAACCCAGCCAGGG - Intergenic
1010960974 6:82145532-82145554 GTTTAAGCAGAACCCAGGAAGGG + Intergenic
1015128658 6:129785119-129785141 ATCTAGGCAGAAGCCGGGAATGG + Intergenic
1025582027 7:62731647-62731669 GTTTTGGCAGAACCCATGAAGGG + Intergenic
1025592760 7:62883533-62883555 GTTTAGGCAGAATCCCAGGAAGG + Intergenic
1027829433 7:83159286-83159308 CTTTAGGAAGAAGCCCAGTAGGG + Intronic
1037321825 8:17650972-17650994 CCTTAGGGAGAATCCAGGAAGGG + Intronic
1040377800 8:46843220-46843242 CTCTAGGCAGAACCTAGAAAGGG - Intergenic
1041518867 8:58732689-58732711 CTTTAGACAGAACTCAGTAAAGG + Intergenic
1041823780 8:62068492-62068514 CATTAGGCAGTACCCCAGTAGGG - Intergenic
1046144309 8:110137660-110137682 TTTTAGGAAGATCCACGGAATGG - Intergenic
1049620232 8:143594839-143594861 CTTTAGGCAAAACCACCGCACGG + Intronic
1051633587 9:19162033-19162055 CTTTAGGAAGTAACCCAGAAAGG - Intergenic
1057795763 9:98156877-98156899 CTTAAGGCAGAACACCTGAAGGG - Intronic
1060712983 9:125889383-125889405 CTTTATGCAGAACTCGGGACCGG - Intronic
1062004872 9:134234057-134234079 CTTCAGGCAGAACACCTGCAGGG + Intergenic
1191218794 X:57963332-57963354 CTATAGGCAGAACAGTGGAATGG + Intergenic
1196408205 X:115388055-115388077 CTCTAGTGAGAACCCCTGAATGG + Intergenic
1199986326 X:152954457-152954479 CTTAAGCCAGAAACCCAGAATGG - Intronic
1201125254 Y:10907259-10907281 CTGTAGGCAGACCCCAGAAAAGG - Intergenic