ID: 1007662188

View in Genome Browser
Species Human (GRCh38)
Location 6:43493643-43493665
Sequence CTTTAGGCAGAACCCCGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007662183_1007662188 11 Left 1007662183 6:43493609-43493631 CCTTTCCTCTTCTGCATCTCTGA No data
Right 1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1007662182_1007662188 14 Left 1007662182 6:43493606-43493628 CCTCCTTTCCTCTTCTGCATCTC 0: 1
1: 0
2: 10
3: 107
4: 926
Right 1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1007662184_1007662188 6 Left 1007662184 6:43493614-43493636 CCTCTTCTGCATCTCTGACTTTG 0: 1
1: 0
2: 3
3: 47
4: 447
Right 1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007662188 Original CRISPR CTTTAGGCAGAACCCCGGAA AGG Intronic