ID: 1007665959

View in Genome Browser
Species Human (GRCh38)
Location 6:43513072-43513094
Sequence CAGTGCCAACATCTGCAGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007665955_1007665959 -2 Left 1007665955 6:43513051-43513073 CCACACCTGGCTCCTTACCAGCA 0: 1
1: 0
2: 2
3: 43
4: 320
Right 1007665959 6:43513072-43513094 CAGTGCCAACATCTGCAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 260
1007665956_1007665959 -7 Left 1007665956 6:43513056-43513078 CCTGGCTCCTTACCAGCAGTGCC 0: 1
1: 0
2: 3
3: 21
4: 211
Right 1007665959 6:43513072-43513094 CAGTGCCAACATCTGCAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 260
1007665953_1007665959 2 Left 1007665953 6:43513047-43513069 CCCACCACACCTGGCTCCTTACC 0: 1
1: 0
2: 5
3: 46
4: 369
Right 1007665959 6:43513072-43513094 CAGTGCCAACATCTGCAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 260
1007665954_1007665959 1 Left 1007665954 6:43513048-43513070 CCACCACACCTGGCTCCTTACCA 0: 1
1: 0
2: 20
3: 198
4: 1807
Right 1007665959 6:43513072-43513094 CAGTGCCAACATCTGCAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007665959 Original CRISPR CAGTGCCAACATCTGCAGCA TGG Exonic
901199457 1:7458350-7458372 CAGTTCCCACATCTGCAGAGAGG + Intronic
901236759 1:7671397-7671419 CAGAGACCACCTCTGCAGCAAGG + Intronic
901329309 1:8392720-8392742 CAGAGCAAACATCTGCTGCAAGG + Intronic
901401038 1:9015184-9015206 CAGGGTCAGCAGCTGCAGCAGGG + Exonic
901411162 1:9085044-9085066 CAGTGCCCACATCAACACCAAGG - Intronic
901874368 1:12158565-12158587 CAATCCCCACATCTGCAGCGGGG - Intergenic
903326783 1:22573394-22573416 CAGTGCCCACATCTGTAAAATGG - Intronic
903564841 1:24257446-24257468 CAGTGGCCACATCTGCAAGATGG - Intergenic
904876641 1:33660187-33660209 CGGAGCCCACATCTGCAACATGG + Intronic
905282112 1:36855890-36855912 CAGTGTCCACATCTGCAAAATGG - Intronic
905353139 1:37361197-37361219 CAGTGTCATCATCTGCATCTGGG + Intergenic
910025527 1:82646578-82646600 CAGTGTCATCTTCAGCAGCAGGG - Intergenic
910340847 1:86185227-86185249 CACTTCCAAAATCTTCAGCAAGG + Intergenic
913380485 1:118204860-118204882 CAGTGCCACCACCTGCTGCTGGG - Intergenic
913391510 1:118318196-118318218 CCTTGCCAACAACTGCAGCTTGG - Intergenic
915389467 1:155528500-155528522 CAGTCCCAAAATCTGCAGGGTGG + Intronic
920406182 1:205713683-205713705 CAGTGCTGAAATCTGCAGCATGG - Exonic
920768928 1:208861659-208861681 CATAGCCAACATCTACAGAATGG + Intergenic
924776015 1:247114800-247114822 CAGTCTCCCCATCTGCAGCATGG - Intergenic
1062965979 10:1608165-1608187 CTGTGCCAACGTCTGGAGCGGGG + Intronic
1063185245 10:3644683-3644705 CAGTGCCAAAATTTGAAGTAGGG - Intergenic
1065552381 10:26881861-26881883 CAGTGACAACATAGGCAGCATGG + Intergenic
1066433331 10:35373337-35373359 CATTGCTGACAGCTGCAGCATGG - Intronic
1067789651 10:49278160-49278182 CAGTGGCCTCATCTGCAGGAAGG - Intergenic
1068180451 10:53511814-53511836 CAGTGCCAAAATCTGAATTAGGG - Intergenic
1069852283 10:71417149-71417171 CACTGCCAACCTCTGCTGCTCGG + Intronic
1071547826 10:86541733-86541755 CAAGGCCAACATGGGCAGCATGG + Intergenic
1074545555 10:114399616-114399638 CAGAGCCACCCTCTGCAACACGG - Intronic
1075329976 10:121566846-121566868 CAGTTCCCAGATATGCAGCACGG + Intronic
1076200429 10:128553396-128553418 CAGAGCCAGCAGCTGCATCACGG + Intergenic
1076215971 10:128693614-128693636 CAGTCCCAGTAGCTGCAGCAGGG - Intergenic
1076473864 10:130738929-130738951 CAGTGCCAACATCTGCTTCTGGG - Intergenic
1076682240 10:132179100-132179122 CAGTGCCAAGGGCGGCAGCAGGG - Intronic
1076704920 10:132296049-132296071 CAGGGCCAGCATCGGCAGGAAGG + Intronic
1079087585 11:17457849-17457871 CTGTGCCAACTGCTGCAGGATGG + Intronic
1081055327 11:38403222-38403244 GAGTGCCAATATCTTCAGGAGGG + Intergenic
1081731743 11:45376577-45376599 CAGCTCAAACATCTGCAGTAGGG - Intergenic
1083200668 11:61119240-61119262 CTGTGCCACCAGCTGCAGCCTGG - Exonic
1083758250 11:64802704-64802726 CAGTGCCCCCATCTGCAAAATGG + Intronic
1083786621 11:64952623-64952645 CAGGGCCAAGATCTGAACCAAGG + Intronic
1083993943 11:66263006-66263028 CAGTGCCAGGATGTTCAGCATGG - Exonic
1085449453 11:76623161-76623183 CAATGGGAACACCTGCAGCATGG - Intergenic
1085802309 11:79601835-79601857 GAGGGCCAACATCTTCAGCCTGG - Intergenic
1088707409 11:112476233-112476255 CAGTGCCAGAAGCTGCAGAAAGG - Intergenic
1089198834 11:116711212-116711234 CAGTGACTACATCTGCTGCCCGG + Intergenic
1089397396 11:118145343-118145365 CAGTGCCAACCTCGGGAGGATGG + Intronic
1090127560 11:124103958-124103980 CAGTTCCACCATCTGCAGGTGGG + Intergenic
1090340959 11:126019840-126019862 TAGAAACAACATCTGCAGCACGG + Intronic
1090392640 11:126398968-126398990 CAGTGCCAAAATCTGAGGGAAGG - Intronic
1090469563 11:126968296-126968318 TATTGCCTACATCTGGAGCATGG - Intronic
1093698443 12:22190113-22190135 TATTGCCAACAACTGCAGAATGG + Intronic
1093916016 12:24803316-24803338 CAGTCCCAACGTCTGCAGCTTGG - Intergenic
1093949467 12:25148277-25148299 CAGATCCACCATCTTCAGCAAGG + Intronic
1096004565 12:48158520-48158542 CATTGCCAACATTTGCAACTTGG - Intronic
1102690939 12:114760532-114760554 CACTGCCACCAACTGCAGCATGG + Intergenic
1104061571 12:125272815-125272837 AAGTGCCAACATCTGTAGCAGGG - Intronic
1104076328 12:125392985-125393007 CTGTGCCCACATTTGCAACAAGG + Intronic
1105210117 13:18252648-18252670 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1105308845 13:19188563-19188585 CAGTGTCAACATCTGCTTCTGGG - Intergenic
1105528748 13:21199584-21199606 CAGTGTCAACATCTGCTTCTGGG + Intergenic
1105529027 13:21201592-21201614 TAGTGCCAACATCTGCTTCTGGG + Intergenic
1106088892 13:26568634-26568656 CAGTGCCAACAATTGCAGTCTGG + Intronic
1106274952 13:28195326-28195348 CAGTGGCAACCTCTGCTTCAGGG - Intronic
1106636010 13:31528990-31529012 CTGTGCCAACCTCACCAGCAGGG - Intergenic
1107315384 13:39126031-39126053 CACTGCCATTTTCTGCAGCAAGG - Intergenic
1107650513 13:42540422-42540444 GAATGCCACCATCTGTAGCAAGG + Intergenic
1107934835 13:45336955-45336977 CAGTGCCAACATCTGAAGTGTGG - Exonic
1107948407 13:45440547-45440569 CAGTGCCAACATAAGCACGAGGG - Intergenic
1110289759 13:73790783-73790805 CAGTACCTACATCTGCAACATGG - Intronic
1111053899 13:82922804-82922826 CAGTTCCAACATCACTAGCAAGG + Intergenic
1111213265 13:85108685-85108707 CAGTCCCACCATTTGCAGCCTGG + Intergenic
1116167389 14:41350626-41350648 GAATGCCAACTGCTGCAGCAGGG - Intergenic
1118412115 14:65491467-65491489 CAGTGGGAATATCAGCAGCATGG + Intronic
1118457961 14:65961860-65961882 CAATGCCAAGACCAGCAGCAGGG + Intronic
1118808406 14:69257095-69257117 CAGTGTCATCATCTGCAGTTGGG + Intergenic
1119548348 14:75489848-75489870 CTGTTCCTTCATCTGCAGCATGG + Intergenic
1120774305 14:88416072-88416094 CAATGCCAGCATCTGCTTCAGGG - Intronic
1122289100 14:100670184-100670206 CAGTTTCCCCATCTGCAGCATGG + Intergenic
1122654267 14:103246823-103246845 CACTGCCAACCTCTGCCGCCCGG - Intergenic
1122673621 14:103391617-103391639 CACTGCCAACCTCTGCCGCCCGG + Intronic
1122928943 14:104924535-104924557 CAATGCCATCATCTCTAGCAAGG + Intergenic
1123136327 14:106030836-106030858 AAGTGCCAAAAGCTGGAGCAGGG - Intergenic
1128074913 15:64820010-64820032 CAGAGCCCACCTGTGCAGCAGGG + Intronic
1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG + Intergenic
1128876928 15:71209363-71209385 CAGTGACTACATCTGCAAAATGG + Intronic
1129688030 15:77697365-77697387 CAGTGGCTGCATCTGCAGCAAGG - Intronic
1130949413 15:88573687-88573709 CAGTGCCCTCAGCAGCAGCATGG + Intergenic
1131424985 15:92338581-92338603 CAGTGCCTACTTCTGCACCAGGG + Intergenic
1133076060 16:3282350-3282372 CAGTGCCACCACCTGTAGGAAGG + Intronic
1133876812 16:9742770-9742792 GGGTACCAACCTCTGCAGCAGGG - Intergenic
1134218508 16:12335076-12335098 AAATGACATCATCTGCAGCAGGG + Intronic
1135109333 16:19678446-19678468 CAGTGCCAACAGCTGAAGTAAGG - Intronic
1135632286 16:24045801-24045823 CACTGCGATCCTCTGCAGCAGGG - Intronic
1135795034 16:25433627-25433649 CAGTGCCCGCATCTAAAGCAGGG + Intergenic
1136537155 16:30906661-30906683 CAGTGCCAGGATCTGAAGCCAGG - Intergenic
1138277175 16:55743519-55743541 CACTGACAGCATCTGCTGCAAGG + Intergenic
1138551402 16:57750849-57750871 CAAAGCCAACATCTGCAGCCTGG + Exonic
1139877309 16:70156642-70156664 CAGTGCCTACAGCTACAGCCTGG + Exonic
1141979437 16:87540929-87540951 CAGTCCCCAGATCAGCAGCAGGG + Intergenic
1142224155 16:88869527-88869549 CAGCGCCCACATCTGCACCGAGG + Intergenic
1142354800 16:89597305-89597327 AAGTGCCCACATCTGAGGCAGGG + Intergenic
1142359942 16:89621247-89621269 CACAGCCCACATCTGCACCAGGG - Intronic
1143359760 17:6359328-6359350 CACTGCCAACCTCTGCCGCCCGG - Intergenic
1143361173 17:6372507-6372529 CAGTGGCAATACCTTCAGCAGGG + Intergenic
1143837124 17:9701382-9701404 CACTGCCAAGTCCTGCAGCAGGG + Exonic
1144315193 17:14053515-14053537 CACTGCCAAGATCTGAGGCATGG - Intergenic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1145059661 17:19724669-19724691 CGGTGCCAACGCCTGCAGCCCGG - Intergenic
1145193661 17:20868634-20868656 CACTGCCAACAACCGCAGCGAGG - Intronic
1145250130 17:21292937-21292959 CAGTTTCCCCATCTGCAGCATGG + Intronic
1145351886 17:22090857-22090879 CACTGCCAACAACCGCAGCGAGG - Intergenic
1146534932 17:33641852-33641874 CAGTGCCTTCATCTGCATAATGG + Intronic
1147613158 17:41813078-41813100 CAGTAGCAGCAACTGCAGCAGGG - Exonic
1149544617 17:57494207-57494229 CATTCCCACCATCTGCAGTAAGG + Intronic
1149561068 17:57608324-57608346 CAGTTCTAACATCTGCTCCAGGG - Intronic
1151106413 17:71621195-71621217 CTTGGCCACCATCTGCAGCATGG - Intergenic
1157214360 18:45770460-45770482 CAGTTTCCACATCTGCAGAATGG - Intergenic
1160495751 18:79373985-79374007 CAGCGCCACCATCAGCAGCTCGG - Exonic
1164145532 19:22510413-22510435 CAGTGCCCACCTCAGAAGCAGGG + Intronic
1164398776 19:27888588-27888610 CAGTGAGAACATCTGCAACATGG + Intergenic
1164511095 19:28897875-28897897 CAGTGAATACTTCTGCAGCATGG + Intergenic
1164526704 19:29018319-29018341 TTGTGCCCTCATCTGCAGCATGG - Intergenic
1164546617 19:29170472-29170494 CAGAGCCAACATTTGGAGAAAGG - Intergenic
1164940945 19:32251940-32251962 CAGTGCCGACATCAGCAGGAGGG + Intergenic
926121252 2:10242290-10242312 CCGTGCCCACCTCTGCAGAAAGG - Intergenic
926131559 2:10305953-10305975 CAGTTCCAAGGTCTGCAGCGCGG + Intronic
926785369 2:16512589-16512611 CAATGGCAACAGCTGCAGCCAGG - Intergenic
927520462 2:23695293-23695315 CAGTGGCCTGATCTGCAGCAGGG + Intronic
927757602 2:25721791-25721813 CAGGGCACACATGTGCAGCAGGG + Intergenic
928469453 2:31559188-31559210 AAGTGGCAACATTTGCAGCCTGG - Intronic
929622952 2:43376032-43376054 CAGAGCCAATATTTACAGCATGG + Intronic
929968256 2:46551522-46551544 CAGTGTCAACATGTGGAGCAGGG + Intronic
930283414 2:49398605-49398627 CACTGCCAGCAGCAGCAGCAGGG + Intergenic
931659422 2:64544838-64544860 CAGAGCCAATACCTGCTGCAGGG + Intronic
932577661 2:72971662-72971684 CAGTGCCAATATCTGCAATGTGG - Exonic
935594828 2:104870230-104870252 CAGTGCCAAGAAATACAGCAGGG - Intergenic
937254612 2:120546368-120546390 CAGTGCAGACATCTGGAGCCAGG - Intergenic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
938961138 2:136342773-136342795 CAGTTCCATCATCTGTAACATGG + Intergenic
941942875 2:171062019-171062041 CAGAGCCACCATCTAGAGCAGGG - Intronic
943679657 2:190755084-190755106 CTGTGCCAAAATCTGCTCCAAGG - Intergenic
944749756 2:202696865-202696887 CAGTACCAACCTGGGCAGCATGG + Intronic
946005393 2:216520427-216520449 CAGGGCCAAAATCAGCTGCAGGG + Intronic
948269759 2:236665265-236665287 CAGTGCCAATTTCAGCAGGAAGG + Intergenic
948399758 2:237675058-237675080 CAGAACCAACAACTGCAGCCAGG - Intronic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1169114115 20:3051876-3051898 CAGTTCCAACAGCAGCAGCAGGG - Intergenic
1169674555 20:8139160-8139182 CACTGCCAACCTCTGCAGCCGGG + Intronic
1170853216 20:20022916-20022938 CTGTGGCAACATCTGGAACAAGG - Intronic
1171291263 20:23984338-23984360 CAGTTCCAACACCTGGGGCAGGG - Intergenic
1171387861 20:24782334-24782356 CACTGCCAACGTCGGCAGCACGG + Intergenic
1172173674 20:32959882-32959904 CAGGGCCATCTTCTGCAGCTTGG - Intronic
1173640013 20:44594989-44595011 CACTGCAAACATCTGCACCCAGG - Intronic
1174564126 20:51452470-51452492 CCATGACAACATCTGCAGCCAGG + Intronic
1174875772 20:54224822-54224844 CAGTGCCAACCTCCGCCGCCCGG + Intronic
1175159006 20:56994231-56994253 CTGGGCAAACATCAGCAGCAAGG + Intergenic
1175485456 20:59342748-59342770 CAGTTCCCACATCTGCAGAAGGG - Intergenic
1175860813 20:62149129-62149151 CACTGCCACCACCTGCAGCCCGG - Intronic
1176808421 21:13514739-13514761 CTCTGCCACCAACTGCAGCAAGG + Intergenic
1178853887 21:36235149-36235171 TAGTTCCAGCATCTGCAACAGGG - Intronic
1179013565 21:37575093-37575115 CAGTGTCTCCATCTGCAGTAGGG + Intergenic
1179642121 21:42754546-42754568 CTGTGTCACCTTCTGCAGCAAGG + Intronic
1180183321 21:46127569-46127591 CAGGGTCCACATCAGCAGCAGGG + Intronic
1180746621 22:18093632-18093654 CAGTGCTGAAACCTGCAGCATGG - Exonic
1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG + Intergenic
1180780173 22:18515622-18515644 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1180812889 22:18772943-18772965 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1181199067 22:21207259-21207281 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1181335687 22:22126076-22126098 CACTGCCACCAACCGCAGCAAGG - Intergenic
1181400697 22:22648597-22648619 CAGTTCCAACACCTGGGGCAGGG + Intergenic
1181702677 22:24629695-24629717 CAGTTCCAACACCTGGGGCAGGG + Intergenic
1181769556 22:25115450-25115472 CAGTGCCCTCATCTGAAACATGG + Intronic
1182083554 22:27545693-27545715 CAGTACCTACATGTCCAGCAAGG + Intergenic
1182235139 22:28869186-28869208 CAGTGGCAAGATCTCCAGCTCGG + Intergenic
1182294305 22:29304215-29304237 CAGTGGCACCATCTGCAGAATGG - Intergenic
1182309660 22:29395522-29395544 CACTGAGGACATCTGCAGCAAGG - Intronic
1183655954 22:39184839-39184861 CTGTGCCCACTCCTGCAGCAAGG + Intergenic
1183669432 22:39263770-39263792 CAGTTTCAACATCTGAAGTATGG - Intergenic
1184419604 22:44372021-44372043 CAGTGCCAGCACCCACAGCAAGG + Intergenic
1203227758 22_KI270731v1_random:87647-87669 CAGTTCCAACACCTGGAGCAGGG + Intergenic
949211757 3:1511477-1511499 CAGTGTCAACATCTTCAGCTGGG - Intergenic
949652952 3:6182043-6182065 CAGTGCCAGCATCTGGACCTAGG - Intergenic
949903518 3:8839205-8839227 CAGTTTCCACATCTGCAGAATGG + Intronic
950195876 3:11008791-11008813 TAGTGCCATCATCTGCAAAATGG + Intronic
951093917 3:18606566-18606588 CAATGCCAATGTCTGCAGCCAGG - Intergenic
951705215 3:25537504-25537526 CAGTGACTACATCTGCAATATGG - Intronic
953793909 3:45968287-45968309 CTGTGCCAAGGGCTGCAGCATGG + Exonic
954428219 3:50454794-50454816 CTGGGCCAGCCTCTGCAGCATGG + Intronic
954449766 3:50565531-50565553 CCGTGCCACCAGCTGCATCAGGG + Exonic
954752944 3:52823883-52823905 CAGTGCCAGCTTCTCCAGGAAGG + Exonic
956065180 3:65390175-65390197 CAGTGACCACATTTGCAGCTAGG + Intronic
959632099 3:108518379-108518401 CCCTGCCAACATCTGGATCAAGG + Intronic
959726877 3:109553364-109553386 CAGTGCCCACATCTGTACAATGG - Intergenic
961184742 3:124904939-124904961 CAGAGCCAACCTCTGTAGCTGGG + Intergenic
961617291 3:128192974-128192996 CAGTGCCAACATTTGAACCCAGG - Intronic
962403057 3:135078027-135078049 CAGTTCCATCATCTGCAAAATGG - Intronic
964504356 3:157382126-157382148 CAGTGAGAAAACCTGCAGCAAGG - Intronic
964790976 3:160452979-160453001 CAGTGGCAACACCTACAGCTGGG + Intronic
966631698 3:182083216-182083238 AAATCCCCACATCTGCAGCATGG - Intergenic
966641191 3:182192243-182192265 CAGTGCCAGCATCTGCTTCTGGG - Intergenic
966761495 3:183423215-183423237 CAGTACCAACAGCTGAGGCATGG + Intronic
967345036 3:188445835-188445857 CATCTCCAACATATGCAGCAAGG + Intronic
967674607 3:192281619-192281641 CAGTGCGACCTTCGGCAGCATGG - Intronic
967997604 3:195178654-195178676 CAGTGCCCAGCTCTGAAGCACGG + Intronic
968663795 4:1810037-1810059 CAGTGCCAGCATCCACACCAAGG + Intergenic
968932120 4:3586692-3586714 CAGTGCCAACAGCAACAACAAGG + Intronic
969238517 4:5884849-5884871 CAGAGCCAACAGCTTCTGCAGGG + Intronic
970445719 4:16121885-16121907 CAGTGGAATCATCTGCAGTAGGG + Intergenic
970772891 4:19637463-19637485 CAGTGTCATCATCTGTAGTAAGG + Intergenic
971147359 4:23993593-23993615 CAGTTTCAACATCTGCAAAATGG - Intergenic
974272210 4:59664976-59664998 CAGAGCCAGCAGCTGCATCAGGG - Intergenic
974866242 4:67584168-67584190 CAATGCTAACATTTGCAGCAGGG + Intronic
978964704 4:114726107-114726129 CAGTGGTACCAGCTGCAGCAGGG - Intergenic
980666311 4:135941247-135941269 CAGTGCCAGCATCTGCTTCTGGG - Intergenic
982369512 4:154619636-154619658 CAGAGCAAAAATCTGTAGCAAGG + Intergenic
984071254 4:175116077-175116099 CAAAGCCAACATCAGCTGCATGG + Intergenic
984754502 4:183313168-183313190 CAGTGCCAAGCTCTGGCGCATGG + Intronic
985134357 4:186770330-186770352 CATTGCCAACATCAGCACAAAGG - Intergenic
985436280 4:189932324-189932346 TAGTGCCAACATCTGCTTCTGGG + Intergenic
986339953 5:6780377-6780399 CAGTGCATACATCTGCAGAAAGG + Intergenic
986755608 5:10833113-10833135 CAGTCTGAGCATCTGCAGCATGG - Intergenic
987831981 5:23105890-23105912 CAGTGCCAACATATGTACCCAGG + Intergenic
990389365 5:55303275-55303297 CAGTGTGTACATCTGCAGAATGG + Intronic
992134561 5:73730734-73730756 CAGTTCCAACCTGTGCAACATGG - Intronic
994356331 5:98797821-98797843 CAGGGAGAAAATCTGCAGCAAGG - Intronic
995017438 5:107326816-107326838 CAGTGACAACATCTGCTACAGGG + Intergenic
995531028 5:113091999-113092021 CATTGCCAACACCTTCAACAGGG + Intronic
995807767 5:116072973-116072995 CAGTTCCTACATCTCCAGAAGGG - Intergenic
996044928 5:118861409-118861431 CAGGGCCAACATTTGCCTCAGGG - Intronic
999119834 5:149200651-149200673 CAGTGCCAATATTTGCCACATGG + Intronic
999134853 5:149311807-149311829 CAGTGTCCACATCTGCAACATGG - Intronic
999762318 5:154712274-154712296 CAGTTTCCACATCTGTAGCATGG - Intergenic
1001912810 5:175534857-175534879 CAGTGCCCACAGAAGCAGCATGG + Intergenic
1003317157 6:5023463-5023485 CAGAGCCACCACGTGCAGCATGG + Intergenic
1003403209 6:5807772-5807794 CAGTGCCAACATCTGCTTCTGGG - Intergenic
1004501209 6:16211693-16211715 CACTGCCAACCTCTGCCGCTGGG - Intergenic
1005016273 6:21378107-21378129 CAGTGTCACCTGCTGCAGCAAGG + Intergenic
1006342855 6:33456095-33456117 CAGGGCCAACATCTGGGGGAGGG + Exonic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007665959 6:43513072-43513094 CAGTGCCAACATCTGCAGCATGG + Exonic
1009275704 6:61676522-61676544 CACTGACAACATCTGCATCCTGG + Intergenic
1010215290 6:73395536-73395558 CACTGCCAACTTCTGCCGCCGGG - Intronic
1010785341 6:79993814-79993836 CAGTGCCAGCATCTGCTACTGGG - Intergenic
1012929132 6:105298501-105298523 CAGTGTCAACCCCTGCACCAAGG - Intronic
1015390692 6:132678247-132678269 CAGTGCCAGCATCTGCTTCTGGG + Intergenic
1017511715 6:155120030-155120052 ACATCCCAACATCTGCAGCATGG - Intronic
1018857764 6:167687714-167687736 CACTGCCAACACCTGCAGCAAGG - Intergenic
1021624905 7:22583480-22583502 CAGTGCCAACATATGTTGCTTGG - Intronic
1022333291 7:29399956-29399978 CACTGGCAACAGCTCCAGCAGGG + Intronic
1022668634 7:32433969-32433991 CACTGCCAACCTCTGCCGCCTGG - Intergenic
1023996461 7:45161826-45161848 CAGTGCCCACACCTGCAGCCTGG - Intronic
1024326103 7:48110313-48110335 CAGTGCCAATAGCTGCAGCTTGG - Intergenic
1024357108 7:48425514-48425536 CAGTGCCCTCATCTTAAGCAAGG + Intronic
1025275634 7:57579565-57579587 CACTGCCAACAACCGCAGCAAGG + Intergenic
1026569181 7:71514453-71514475 CAGTGCCTACATCTCAAGGAAGG - Intronic
1027994770 7:85411731-85411753 CATTGGCTACAGCTGCAGCAGGG + Intergenic
1029198535 7:98823372-98823394 CAGTGTCCACATCTGCAAAATGG - Intergenic
1029738558 7:102478614-102478636 CAGTGTCCTCATCTGCAACATGG + Intronic
1029773637 7:102671358-102671380 CAGTGTCCTCATCTGCAACATGG + Intronic
1030381687 7:108818556-108818578 CACTTTCAACATCTGCATCAAGG - Intergenic
1033530365 7:142256870-142256892 CAGAGGCAACAGCTGCAGCATGG + Intronic
1033724872 7:144104164-144104186 CAGTGCCCCCATCTGCAAAATGG - Intergenic
1034087744 7:148335410-148335432 CACTGCCCACACCTCCAGCAGGG + Intronic
1034656742 7:152735829-152735851 CTGTCCCAGCATCTGCAGCGTGG + Intergenic
1037318415 8:17621141-17621163 CAGCGGCTACATCTGCAGGAAGG + Exonic
1037499158 8:19469053-19469075 CAGTGCCAACCACTGCACCAAGG + Intronic
1038337283 8:26655679-26655701 CCGTGCCAACATCACCAGCCTGG + Exonic
1038844329 8:31214877-31214899 CAGTGTCAAGATCTGTTGCAAGG + Intergenic
1041007455 8:53509046-53509068 CAGCACCAACACCTGCAGCTTGG - Intergenic
1041963164 8:63643392-63643414 CATTGCCAAAATCTGCAACCTGG - Intergenic
1042987801 8:74603597-74603619 CATTGCCAACTGGTGCAGCATGG + Intronic
1043058892 8:75475082-75475104 CAGTGCCAACCTCTGCCTCCCGG + Intronic
1048713044 8:137233409-137233431 CAGTGCCAACCTATGGAGCAGGG + Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049657292 8:143804515-143804537 CAGTGCCCACAGCTGAAGCTGGG + Intronic
1050106067 9:2168084-2168106 CAGTGGCAACATCTGCCTCCCGG + Intronic
1050283874 9:4080823-4080845 CAGTGGCAATACCTGCAGCCAGG + Intronic
1050306942 9:4314314-4314336 CAGTGCCAAGACATGCAGCCTGG - Intronic
1050907941 9:11028363-11028385 TAGTGCCAACATCTGCTTCTGGG + Intergenic
1051339549 9:16098927-16098949 CAGTGCCAAGTCCTGCATCAGGG + Intergenic
1052139535 9:24962120-24962142 CACTGCCAATATCAGCAGAATGG + Intergenic
1052849444 9:33367857-33367879 CAGTGTCACCATCTACACCATGG - Intronic
1055335894 9:75233167-75233189 GAATGGCAACATCTGCAGCGGGG - Intergenic
1058673804 9:107383140-107383162 CAGTGGCCTCATCTGCAGAATGG + Intergenic
1059252624 9:112900097-112900119 CAGTGACAAGCTCTGCAACAAGG + Intergenic
1059283098 9:113151204-113151226 CATTGCCAACAGCTGGAACAGGG + Intronic
1059366987 9:113793995-113794017 CAGTTTCTACATCTGCAGAATGG + Intergenic
1060151885 9:121294221-121294243 CGGTCCCAGCATCTGCAGCCAGG + Intronic
1060448728 9:123716880-123716902 CAATGCCAACATTTTTAGCAGGG + Intronic
1060790440 9:126482253-126482275 CAAGGCCAACTTCTGCAGAAAGG - Intronic
1187299780 X:18037015-18037037 CAGTGCCAAAAACTTCATCAGGG + Intergenic
1192438805 X:71159798-71159820 CACTGCCAACCTCTGCCGCCGGG + Intronic
1193455762 X:81729724-81729746 CCATGCCAAAATCTGCTGCAGGG + Intergenic
1196094278 X:111781818-111781840 CACTGCCAACCTCTGCTGCCTGG - Intronic
1197873670 X:131083077-131083099 CAATGCCCTGATCTGCAGCAGGG - Intronic
1197986256 X:132269306-132269328 CAGTGCTAACAACTTGAGCAGGG - Intergenic
1199001224 X:142639323-142639345 CACTGCCAACCTCTGCTGCCCGG + Intergenic
1199259866 X:145759870-145759892 AAGTGCCAAGGTCTGAAGCAGGG + Intergenic
1200103878 X:153701809-153701831 AAGTGCCTACATCTGCTGCCAGG + Intronic
1200138093 X:153884751-153884773 AAGTCCCACCACCTGCAGCAAGG + Intronic
1200232272 X:154449965-154449987 CAGTGACAACATCGGCGGCAAGG - Intronic
1200283581 X:154799839-154799861 CAGAGGAAACATCTGCAGCAGGG + Intronic
1201505127 Y:14690055-14690077 CAGTGCCACCATCCCCATCATGG + Intronic