ID: 1007666542

View in Genome Browser
Species Human (GRCh38)
Location 6:43516835-43516857
Sequence TCCGCGCGCGGGGCTAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 76}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007666542_1007666552 4 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666552 6:43516862-43516884 GCAAGATGTGGGCCTCCGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 96
1007666542_1007666555 17 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666555 6:43516875-43516897 CTCCGGAAGGTAGACGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1007666542_1007666558 28 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666558 6:43516886-43516908 AGACGTCCAGGGTCGAGGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 113
1007666542_1007666550 -7 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666550 6:43516851-43516873 GCGCGGAGTGGGCAAGATGTGGG 0: 1
1: 0
2: 1
3: 0
4: 83
1007666542_1007666557 23 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666557 6:43516881-43516903 AAGGTAGACGTCCAGGGTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1007666542_1007666554 16 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666554 6:43516874-43516896 CCTCCGGAAGGTAGACGTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 45
1007666542_1007666549 -8 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666549 6:43516850-43516872 CGCGCGGAGTGGGCAAGATGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1007666542_1007666551 0 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666551 6:43516858-43516880 GTGGGCAAGATGTGGGCCTCCGG 0: 1
1: 1
2: 8
3: 28
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007666542 Original CRISPR TCCGCGCGCGGGGCTAGCGC GGG (reversed) Exonic
900032648 1:382079-382101 TCTGCGGCCGGGGCCAGCGCAGG + Intergenic
900053406 1:611141-611163 TCTGCGGCCGGGGCCAGCGCAGG + Intergenic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
915891985 1:159781369-159781391 TCAGCGGGCGGGGTCAGCGCAGG + Intronic
923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG + Intergenic
1063115538 10:3068977-3068999 TGAGCGCGCGGGGCGGGCGCGGG + Intronic
1063200996 10:3785313-3785335 GCCGCGCACGGGGCGGGCGCGGG - Intergenic
1063965688 10:11344331-11344353 CACGCGCGCCGGGCTAGCGCAGG - Intergenic
1065522288 10:26584550-26584572 GCCGCAAGCGGGGCTAGCTCAGG + Intergenic
1072710716 10:97714136-97714158 TCCCCGTGCTGGGCTCGCGCTGG + Exonic
1078771699 11:14358392-14358414 TCCGGGCGTGGGGCTGGAGCTGG - Intronic
1090645606 11:128764734-128764756 GCCGCACGCAGGGCTTGCGCTGG + Intronic
1092365494 12:7873287-7873309 CCCGCCCGCGGGGATAGCCCGGG - Intronic
1094218495 12:27970311-27970333 AACGCGCGCGGGGCGAGCGAGGG + Intronic
1096241336 12:49961808-49961830 GCCGGGCGCGGGGCCGGCGCGGG - Intergenic
1097794167 12:63844438-63844460 GGCGGGCGCGGGGCTCGCGCCGG - Exonic
1102973536 12:117190116-117190138 TCCGCGCGCGGGGCGGCCGCGGG + Intronic
1105957926 13:25301571-25301593 TACGTGCGCGCGGCGAGCGCCGG + Exonic
1115770097 14:36658701-36658723 TCCGCGGGCCGCTCTAGCGCCGG + Intronic
1117254479 14:53963882-53963904 TCCGCGCGGGTGGCTCGCCCAGG - Intergenic
1122904553 14:104795770-104795792 TCCGGGCGCGGGGCGGGCGCGGG - Intergenic
1122960884 14:105093234-105093256 ACCGCGGGCGGGGCTGGGGCCGG + Intergenic
1124940074 15:34209912-34209934 TGCGGGCGCGGGGCTCGCACCGG + Intronic
1125464077 15:39934009-39934031 TCCGCGCCGGGAGCTAGCTCCGG - Intergenic
1126668453 15:51094806-51094828 CCTGCGCGCGAGGCGAGCGCAGG + Intronic
1127789912 15:62390552-62390574 TCCGCGCCCGGAGCCAGCGGCGG + Intronic
1128344145 15:66842862-66842884 TCCGGGCGCGGGGCCAGGTCGGG + Intergenic
1130362987 15:83207773-83207795 CCCGGGCGCGGCGCGAGCGCCGG + Exonic
1132570618 16:642378-642400 TCCGGGCGCGGGGGGTGCGCGGG + Intronic
1136146706 16:28320615-28320637 TGCGCGCGCGGTGCGAGGGCCGG - Exonic
1139451230 16:67029358-67029380 GCCGCGCTCGGGGCTTGCGCGGG - Exonic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1139705439 16:68737720-68737742 TCCGCGGGGTGGGCTCGCGCGGG + Intronic
1142240381 16:88941928-88941950 GCCGCGCTGGGGGCGAGCGCGGG - Intronic
1144854158 17:18258755-18258777 GCCGCGGGCTGGGCCAGCGCCGG + Exonic
1152831004 17:82497047-82497069 CCGGCGCGCGCGGCTGGCGCTGG - Intergenic
1152947292 17:83205106-83205128 TCTGCGGCCGGGGCCAGCGCAGG - Intergenic
1154125567 18:11689521-11689543 GCGGCGCGCGGGACTAGGGCAGG - Exonic
1155654556 18:28177944-28177966 GCAGCGCGTGGGGCGAGCGCGGG - Intergenic
1155928770 18:31684967-31684989 TGCCTGCGCGGGGCTAGCGTGGG + Intronic
1160631249 18:80247528-80247550 GCCGCGCGCGGGAGGAGCGCGGG + Exonic
1160793498 19:933517-933539 TCCTCGCCCGGGGCTGGAGCTGG + Intronic
1162412949 19:10517461-10517483 TCCGGGGGCGGGGCTGGAGCTGG + Intronic
927751442 2:25673664-25673686 TCCGCGCGCGGGGAGGGGGCGGG + Intergenic
928303508 2:30147246-30147268 TCCGCCCGCGGTCCCAGCGCCGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
935692536 2:105744664-105744686 TACGGGCGCCGGGATAGCGCGGG - Intergenic
942446605 2:176082499-176082521 TCCGCGCGCAGCGCCAGCGCCGG - Intronic
942449622 2:176100760-176100782 GCCGCGCGCGTGGCCAGGGCCGG + Exonic
944221862 2:197310945-197310967 TGCGGGCGCGGGGGCAGCGCCGG - Intronic
1169065680 20:2693160-2693182 CCCGCCCGCGGCGCCAGCGCGGG - Intronic
1176173692 20:63707924-63707946 GCGCCGCGCGGGGTTAGCGCGGG - Exonic
950940042 3:16883894-16883916 TCCGTGCGCGGGGCTGGGGCAGG + Intronic
954110397 3:48429929-48429951 TCCGGGCGCGGGGCGAGGCCGGG - Intronic
954795899 3:53161273-53161295 TCCGCGCGGCGGGCGGGCGCCGG - Exonic
967171794 3:186827567-186827589 TCCGCCCGCCGCGCTCGCGCAGG - Intergenic
969295655 4:6269582-6269604 TCCGCGGGCGGGGCGGGGGCGGG + Intergenic
969912276 4:10457424-10457446 CGCACGCGCGGGGCTGGCGCGGG - Intergenic
977607221 4:98995548-98995570 TGCGCGCGCGGGGCGGGGGCGGG + Intergenic
981280672 4:142954674-142954696 TCCGCCCGCGGCCCCAGCGCAGG + Intergenic
985521093 5:374162-374184 TCCGCGGGCTGGGGCAGCGCGGG - Intronic
991587532 5:68215704-68215726 GCCGGAGGCGGGGCTAGCGCCGG + Exonic
995784639 5:115815835-115815857 TCCGCGCCCGGGGTTAACGATGG + Intronic
1002741172 5:181436789-181436811 TCTGCGGCCGGGGCCAGCGCAGG - Intergenic
1004720593 6:18264700-18264722 TGCGCGCGCGGGGCTCTCCCCGG + Exonic
1007666542 6:43516835-43516857 TCCGCGCGCGGGGCTAGCGCGGG - Exonic
1008545174 6:52577268-52577290 GCCGGGCGCGGCGCTGGCGCGGG - Intergenic
1010794837 6:80106771-80106793 TCCTGGCGCGGGGCTGGCGCGGG + Exonic
1014851034 6:126340064-126340086 TCCGGGGGCGGGGCTTGCTCAGG + Intergenic
1017174986 6:151494204-151494226 GCCGCGCGCGGGGGTGGCCCTGG + Intronic
1019246286 6:170712486-170712508 TCTGCGGCCGGGGCCAGCGCGGG - Intergenic
1019298514 7:291209-291231 TCCGCGCGCGGGGGGCGCCCAGG + Intergenic
1019343004 7:517352-517374 TCCGCGCGCGGGGAGGGCGCGGG - Intronic
1022101062 7:27169439-27169461 TCTGCGCGCGGGGGTCGGGCCGG - Intronic
1035501786 8:95203-95225 TCTGCGGCCGGGGCCAGCGCGGG + Intergenic
1037116722 8:15236938-15236960 CCCGCGCCTGGGGCTAGGGCAGG + Intronic
1037769370 8:21789643-21789665 TGTGCGCGCGGGGCTAGGCCGGG - Intronic
1052781260 9:32783576-32783598 TCTGCGCGCTGAGCTGGCGCCGG + Exonic
1057550560 9:96048774-96048796 TCCCCGTGCGGGGCCAGCCCAGG + Intergenic
1061973970 9:134059195-134059217 TCCGCGGGCGGGGGCAGCTCTGG - Intronic
1062349899 9:136133457-136133479 TCCGGGCGCGGGGCTGGGGGCGG - Intergenic
1062501086 9:136852331-136852353 TCAGCGTGCGGGGCCAGCGCAGG + Intronic
1062696069 9:137877256-137877278 TCCACGCACGGGGCTGGCTCCGG - Intergenic
1203607050 Un_KI270748v1:67869-67891 TCTGCGGCCGGGGCCAGCGCGGG - Intergenic
1186862748 X:13689386-13689408 GGTGCGCGCGGGGCTAGCGCGGG + Intronic
1189336777 X:40175265-40175287 TACGCGCGCGGGGCCAGCCGGGG - Intronic
1190881552 X:54495682-54495704 TCCCCGCGCGGGGCCGGGGCCGG - Exonic
1199736785 X:150693302-150693324 GCGGCGCGCGGGGCCGGCGCCGG - Intronic
1200217533 X:154374679-154374701 GCCGGGCGCGGGGCGGGCGCGGG - Intergenic