ID: 1007666542

View in Genome Browser
Species Human (GRCh38)
Location 6:43516835-43516857
Sequence TCCGCGCGCGGGGCTAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 76}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007666542_1007666554 16 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666554 6:43516874-43516896 CCTCCGGAAGGTAGACGTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 45
1007666542_1007666551 0 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666551 6:43516858-43516880 GTGGGCAAGATGTGGGCCTCCGG 0: 1
1: 1
2: 8
3: 28
4: 259
1007666542_1007666558 28 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666558 6:43516886-43516908 AGACGTCCAGGGTCGAGGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 113
1007666542_1007666557 23 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666557 6:43516881-43516903 AAGGTAGACGTCCAGGGTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1007666542_1007666549 -8 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666549 6:43516850-43516872 CGCGCGGAGTGGGCAAGATGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1007666542_1007666555 17 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666555 6:43516875-43516897 CTCCGGAAGGTAGACGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1007666542_1007666550 -7 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666550 6:43516851-43516873 GCGCGGAGTGGGCAAGATGTGGG 0: 1
1: 0
2: 1
3: 0
4: 83
1007666542_1007666552 4 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666552 6:43516862-43516884 GCAAGATGTGGGCCTCCGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007666542 Original CRISPR TCCGCGCGCGGGGCTAGCGC GGG (reversed) Exonic