ID: 1007666549

View in Genome Browser
Species Human (GRCh38)
Location 6:43516850-43516872
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007666542_1007666549 -8 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666549 6:43516850-43516872 CGCGCGGAGTGGGCAAGATGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1007666538_1007666549 16 Left 1007666538 6:43516811-43516833 CCTTGAGGGCTCCCGTCGCTGAA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1007666549 6:43516850-43516872 CGCGCGGAGTGGGCAAGATGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1007666540_1007666549 4 Left 1007666540 6:43516823-43516845 CCGTCGCTGAAACCCGCGCTAGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1007666549 6:43516850-43516872 CGCGCGGAGTGGGCAAGATGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1007666537_1007666549 17 Left 1007666537 6:43516810-43516832 CCCTTGAGGGCTCCCGTCGCTGA 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1007666549 6:43516850-43516872 CGCGCGGAGTGGGCAAGATGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1007666539_1007666549 5 Left 1007666539 6:43516822-43516844 CCCGTCGCTGAAACCCGCGCTAG 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1007666549 6:43516850-43516872 CGCGCGGAGTGGGCAAGATGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1007666543_1007666549 -9 Left 1007666543 6:43516836-43516858 CCGCGCTAGCCCCGCGCGCGGAG 0: 1
1: 0
2: 1
3: 9
4: 79
Right 1007666549 6:43516850-43516872 CGCGCGGAGTGGGCAAGATGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1007666536_1007666549 23 Left 1007666536 6:43516804-43516826 CCATGTCCCTTGAGGGCTCCCGT 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1007666549 6:43516850-43516872 CGCGCGGAGTGGGCAAGATGTGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type