ID: 1007666551

View in Genome Browser
Species Human (GRCh38)
Location 6:43516858-43516880
Sequence GTGGGCAAGATGTGGGCCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 1, 2: 8, 3: 28, 4: 259}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007666538_1007666551 24 Left 1007666538 6:43516811-43516833 CCTTGAGGGCTCCCGTCGCTGAA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1007666551 6:43516858-43516880 GTGGGCAAGATGTGGGCCTCCGG 0: 1
1: 1
2: 8
3: 28
4: 259
1007666540_1007666551 12 Left 1007666540 6:43516823-43516845 CCGTCGCTGAAACCCGCGCTAGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1007666551 6:43516858-43516880 GTGGGCAAGATGTGGGCCTCCGG 0: 1
1: 1
2: 8
3: 28
4: 259
1007666539_1007666551 13 Left 1007666539 6:43516822-43516844 CCCGTCGCTGAAACCCGCGCTAG 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1007666551 6:43516858-43516880 GTGGGCAAGATGTGGGCCTCCGG 0: 1
1: 1
2: 8
3: 28
4: 259
1007666542_1007666551 0 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666551 6:43516858-43516880 GTGGGCAAGATGTGGGCCTCCGG 0: 1
1: 1
2: 8
3: 28
4: 259
1007666537_1007666551 25 Left 1007666537 6:43516810-43516832 CCCTTGAGGGCTCCCGTCGCTGA 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1007666551 6:43516858-43516880 GTGGGCAAGATGTGGGCCTCCGG 0: 1
1: 1
2: 8
3: 28
4: 259
1007666546_1007666551 -10 Left 1007666546 6:43516845-43516867 CCCCGCGCGCGGAGTGGGCAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1007666551 6:43516858-43516880 GTGGGCAAGATGTGGGCCTCCGG 0: 1
1: 1
2: 8
3: 28
4: 259
1007666543_1007666551 -1 Left 1007666543 6:43516836-43516858 CCGCGCTAGCCCCGCGCGCGGAG 0: 1
1: 0
2: 1
3: 9
4: 79
Right 1007666551 6:43516858-43516880 GTGGGCAAGATGTGGGCCTCCGG 0: 1
1: 1
2: 8
3: 28
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007666551 Original CRISPR GTGGGCAAGATGTGGGCCTC CGG Exonic