ID: 1007666555

View in Genome Browser
Species Human (GRCh38)
Location 6:43516875-43516897
Sequence CTCCGGAAGGTAGACGTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007666543_1007666555 16 Left 1007666543 6:43516836-43516858 CCGCGCTAGCCCCGCGCGCGGAG 0: 1
1: 0
2: 1
3: 9
4: 79
Right 1007666555 6:43516875-43516897 CTCCGGAAGGTAGACGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1007666539_1007666555 30 Left 1007666539 6:43516822-43516844 CCCGTCGCTGAAACCCGCGCTAG 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1007666555 6:43516875-43516897 CTCCGGAAGGTAGACGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1007666540_1007666555 29 Left 1007666540 6:43516823-43516845 CCGTCGCTGAAACCCGCGCTAGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1007666555 6:43516875-43516897 CTCCGGAAGGTAGACGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1007666548_1007666555 5 Left 1007666548 6:43516847-43516869 CCGCGCGCGGAGTGGGCAAGATG 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1007666555 6:43516875-43516897 CTCCGGAAGGTAGACGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1007666547_1007666555 6 Left 1007666547 6:43516846-43516868 CCCGCGCGCGGAGTGGGCAAGAT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1007666555 6:43516875-43516897 CTCCGGAAGGTAGACGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1007666546_1007666555 7 Left 1007666546 6:43516845-43516867 CCCCGCGCGCGGAGTGGGCAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1007666555 6:43516875-43516897 CTCCGGAAGGTAGACGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1007666542_1007666555 17 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666555 6:43516875-43516897 CTCCGGAAGGTAGACGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007666555 Original CRISPR CTCCGGAAGGTAGACGTCCA GGG Exonic