ID: 1007666557

View in Genome Browser
Species Human (GRCh38)
Location 6:43516881-43516903
Sequence AAGGTAGACGTCCAGGGTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007666542_1007666557 23 Left 1007666542 6:43516835-43516857 CCCGCGCTAGCCCCGCGCGCGGA 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1007666557 6:43516881-43516903 AAGGTAGACGTCCAGGGTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1007666543_1007666557 22 Left 1007666543 6:43516836-43516858 CCGCGCTAGCCCCGCGCGCGGAG 0: 1
1: 0
2: 1
3: 9
4: 79
Right 1007666557 6:43516881-43516903 AAGGTAGACGTCCAGGGTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1007666546_1007666557 13 Left 1007666546 6:43516845-43516867 CCCCGCGCGCGGAGTGGGCAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1007666557 6:43516881-43516903 AAGGTAGACGTCCAGGGTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1007666547_1007666557 12 Left 1007666547 6:43516846-43516868 CCCGCGCGCGGAGTGGGCAAGAT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1007666557 6:43516881-43516903 AAGGTAGACGTCCAGGGTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1007666548_1007666557 11 Left 1007666548 6:43516847-43516869 CCGCGCGCGGAGTGGGCAAGATG 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1007666557 6:43516881-43516903 AAGGTAGACGTCCAGGGTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007666557 Original CRISPR AAGGTAGACGTCCAGGGTCG AGG Exonic