ID: 1007670639

View in Genome Browser
Species Human (GRCh38)
Location 6:43550404-43550426
Sequence CAGTAGGACTTCAGAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007670639_1007670644 29 Left 1007670639 6:43550404-43550426 CCCACTTTTCTGAAGTCCTACTG 0: 1
1: 0
2: 1
3: 24
4: 157
Right 1007670644 6:43550456-43550478 TCTGGCTCTTTTTCCTTCTGTGG 0: 1
1: 0
2: 5
3: 56
4: 548
1007670639_1007670645 30 Left 1007670639 6:43550404-43550426 CCCACTTTTCTGAAGTCCTACTG 0: 1
1: 0
2: 1
3: 24
4: 157
Right 1007670645 6:43550457-43550479 CTGGCTCTTTTTCCTTCTGTGGG 0: 1
1: 0
2: 4
3: 45
4: 477
1007670639_1007670643 11 Left 1007670639 6:43550404-43550426 CCCACTTTTCTGAAGTCCTACTG 0: 1
1: 0
2: 1
3: 24
4: 157
Right 1007670643 6:43550438-43550460 CAACATTTTCTTCATTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007670639 Original CRISPR CAGTAGGACTTCAGAAAAGT GGG (reversed) Intronic
903294050 1:22332473-22332495 CAGTAGGCTTTGAGGAAAGTAGG - Intergenic
907255055 1:53172953-53172975 CATGAGGACGTCAGAAAAGAGGG - Intergenic
907428961 1:54399794-54399816 AAGAAGAACTTCAGAAAATTAGG - Intronic
908546375 1:65166214-65166236 CATTAGGACTCCAGAAAAGAAGG - Intronic
908642738 1:66243340-66243362 CAGTAGGTCTTCAAAAAATGTGG - Intronic
910969522 1:92841561-92841583 TAGTAGGACATCACAGAAGTTGG + Intronic
912626347 1:111207608-111207630 CAGTATGTCTTCAGACAAATGGG - Intronic
917034611 1:170734126-170734148 CAGTAGGACATGACAAAAGCAGG - Intronic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
918085899 1:181245026-181245048 CAACAGGCCTTCAGAAGAGTTGG - Intergenic
924258603 1:242207105-242207127 CAGTAGGTTTTGAGTAAAGTAGG - Intronic
1063696476 10:8340316-8340338 CAGTAGGAAGTCAGATAAGAAGG + Intergenic
1065963132 10:30750400-30750422 CTGTAGGAGTTCAGAAAAGGGGG + Intergenic
1067002869 10:42634071-42634093 CAGAAGGATGTCAGAAAACTGGG + Intronic
1070986326 10:80693104-80693126 CATTAGAACTTCAAAAAAGGAGG - Intergenic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1074046310 10:109842607-109842629 CAGTAGGAATTAAGAAACATGGG + Intergenic
1076458021 10:130616969-130616991 CAGTGGGATTTCAAATAAGTGGG - Intergenic
1077343393 11:2035894-2035916 CAGTTGCCCTTCAGAAAAGGAGG - Intergenic
1078053371 11:7986700-7986722 CAGTAGAAGTTCTGAGAAGTGGG - Intronic
1084305716 11:68281992-68282014 CAAAAGGACTTCACATAAGTGGG + Intergenic
1087238828 11:95752468-95752490 CAGTGGGTCTTCAGAAAGATGGG - Intergenic
1088261658 11:107949860-107949882 CAGTAGTTCTTTAGAAAAGGTGG + Intronic
1088894646 11:114068578-114068600 CAGAAGGAAGTCAGAACAGTGGG + Intronic
1089222420 11:116885020-116885042 CAGTAAGATATCAGAAAAGAAGG + Intronic
1202826379 11_KI270721v1_random:91083-91105 CAGTTGCCCTTCAGAAAAGGAGG - Intergenic
1091872706 12:3908145-3908167 CTGAAGGATTCCAGAAAAGTTGG - Intergenic
1092899819 12:13047818-13047840 GAGTAGGACTTAAGGCAAGTTGG + Intronic
1094687731 12:32735284-32735306 CACTAGGGCTTCAAAATAGTTGG + Intronic
1095363626 12:41374563-41374585 CAGTAGGTCTATAGAAAAGTGGG + Intronic
1097490163 12:60257614-60257636 TAGTAGAACTTCAGAAGAGTTGG + Intergenic
1102003682 12:109574821-109574843 CAGTAGGACTTCTGACAACATGG - Exonic
1104189745 12:126468569-126468591 CAATAGCACTTGAAAAAAGTAGG - Intergenic
1106652317 13:31704730-31704752 CTATAGGATTTCAGAAAAGAAGG + Intergenic
1108911976 13:55565645-55565667 AAGTAGGAATGCAGATAAGTAGG + Intergenic
1112665949 13:101573550-101573572 TAGTAGGATTTGAGAAAATTTGG - Intronic
1114282701 14:21208437-21208459 CAATAGAAATTCAGAATAGTAGG - Intergenic
1115522436 14:34246357-34246379 CAGTAGGTCATCAGGAATGTGGG - Intronic
1116143686 14:41035733-41035755 CAGCAGGAATTCACAAAAGGAGG + Intergenic
1120212459 14:81646989-81647011 CTGTGGCACTTCAGGAAAGTGGG - Intergenic
1120248810 14:82037326-82037348 GAGTATGACTTCAGAGAAGCAGG + Intergenic
1120495098 14:85225229-85225251 CAGTAGGACTAGTTAAAAGTTGG + Intergenic
1121589312 14:95089564-95089586 CAGGAGGACTTTAGTAAAATGGG + Exonic
1123467683 15:20528688-20528710 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1123650430 15:22472354-22472376 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1123727995 15:23123897-23123919 CAGCGGGACTTCAGAGATGTGGG + Intergenic
1123740838 15:23281196-23281218 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1123746160 15:23321362-23321384 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1123761676 15:23438275-23438297 CGGTGGGACTTCAGAGATGTGGG + Intergenic
1124278427 15:28344679-28344701 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1124304273 15:28566929-28566951 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1124533148 15:30523397-30523419 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1124765508 15:32484247-32484269 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1125217586 15:37294164-37294186 CTATAGGAATTCAGAAAAGGAGG + Intergenic
1127981412 15:64037910-64037932 CATTAGCACTTTAGAAGAGTAGG + Intronic
1129826487 15:78638133-78638155 TAGTGGGACTTCAGAGATGTGGG - Intronic
1130111837 15:80971791-80971813 AAGTAGGACCTGAGACAAGTAGG + Intronic
1130774215 15:86961351-86961373 CTGTAGGATTTCTGAAAAATTGG + Intronic
1130964776 15:88689022-88689044 GAGCAGGACTTCTGAAAGGTCGG - Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1140685162 16:77426505-77426527 CAGTATGGTTTTAGAAAAGTGGG - Intronic
1144417973 17:15069710-15069732 CAGGAAGTCTTCACAAAAGTAGG - Intergenic
1146422000 17:32695553-32695575 CAGTAGGACTTCCAATGAGTAGG + Intronic
1150864123 17:68831789-68831811 CAGAATGACTTTAGAAAAGTAGG - Intergenic
1156788810 18:40947712-40947734 CACTAGGACATGAGAGAAGTGGG + Intergenic
1157896736 18:51475985-51476007 TAGGAGTACTTCAGAATAGTTGG - Intergenic
1158178895 18:54689482-54689504 CAGTAGGACTTCAGAGAGCAAGG - Intergenic
1158841024 18:61387527-61387549 CAGTTGGAATTCATTAAAGTCGG + Intronic
1159943626 18:74427308-74427330 CAGTAGCAATTTTGAAAAGTAGG + Intergenic
1160178948 18:76618088-76618110 CAGTAGGAGGCCAGAAGAGTGGG + Intergenic
1167055290 19:47106976-47106998 CAGTAGGGCTTCTGAGAACTGGG - Intronic
1167454092 19:49589760-49589782 GAGGTGGACTTCAGAAAAGGAGG - Intronic
928955335 2:36860894-36860916 CAATAAGACTTTAGAGAAGTGGG + Intronic
929292674 2:40211347-40211369 CAGTAGGACTTCAAAATGTTGGG + Intronic
929909374 2:46075901-46075923 CACCTGGACTTCAGAAAAGCTGG - Intronic
933252547 2:80045089-80045111 CAGCTGGACTTCAGAAATGGTGG + Intronic
937549283 2:123066964-123066986 CAGTATGAGTTCTGAAAGGTTGG - Intergenic
939274009 2:139976587-139976609 CAGCAGGAATGCAGAAAAATTGG + Intergenic
939701498 2:145398185-145398207 CAGTATGACTTCACTAAATTTGG - Intergenic
941459703 2:165754543-165754565 CTGTGGGACTTCTGAAAAATAGG + Intronic
944385804 2:199163389-199163411 CAGAAAGAGTTCAGAAAATTAGG - Intergenic
945290390 2:208120984-208121006 CAGGAGAATTTCAGAAATGTTGG - Intergenic
945300789 2:208214633-208214655 CACCAGGACTTCACACAAGTGGG - Intergenic
945647888 2:212523294-212523316 CAGCAGGAATTTAGAAAACTGGG - Intronic
947722345 2:232377856-232377878 CAGGAGGACTCCAGAAAGCTCGG + Intergenic
947856114 2:233325760-233325782 CTGCAGGGCTTCAGGAAAGTGGG + Intronic
1169930081 20:10823175-10823197 CAGTAGGACTTGAAAAAACTTGG + Intergenic
1173083715 20:39894499-39894521 AAGCAGGACTTCAGGAATGTAGG + Intergenic
1175254824 20:57634924-57634946 CAATAGGGCTTCAGGAAAATAGG + Intergenic
1177717844 21:24863256-24863278 CAGTATGACTGTTGAAAAGTAGG + Intergenic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1183752009 22:39726511-39726533 CAGAAGGACGTCAGAGAAGCAGG - Intergenic
1184153167 22:42649884-42649906 CAGGAGGCCTTCAGCTAAGTGGG - Intergenic
952194857 3:31064664-31064686 TAGTAGAACTTCATATAAGTGGG - Intergenic
955873906 3:63470273-63470295 GAGTAGCAGTACAGAAAAGTTGG - Intronic
957974937 3:87430993-87431015 CAGTAGGACTTTTCAAAATTTGG + Intergenic
963837291 3:150070190-150070212 CAGTAGGATATCAGAGAAGGAGG - Intergenic
966292903 3:178381015-178381037 CAGCAGGAATACATAAAAGTGGG + Intergenic
968531084 4:1092006-1092028 CAGCAGGACTTGAGAAGCGTCGG - Intronic
971705664 4:30039297-30039319 CAATATGAAGTCAGAAAAGTCGG - Intergenic
972704160 4:41524939-41524961 CAGTATGTCTTCAGGATAGTTGG - Intronic
974871023 4:67642209-67642231 CAGTAGGAATCAAGAAAACTTGG - Intronic
975380782 4:73698375-73698397 CAGTAGGGCATTAGAGAAGTAGG - Intergenic
975382686 4:73720309-73720331 GAGCAGGACTTCAGAAAATTGGG - Intergenic
975481009 4:74880350-74880372 AAGTAGCACTTCAGATAAGGAGG + Intergenic
978208210 4:106104896-106104918 CAGCAGCCCTACAGAAAAGTGGG + Intronic
981815086 4:148821480-148821502 CAGTAGGTTTTGAGTAAAGTAGG + Intergenic
983143323 4:164181032-164181054 CAGTGGGACTCCAGTAAAATAGG - Intronic
984002419 4:174266331-174266353 CAGTAGGAATACAGAAAATAAGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985688176 5:1293244-1293266 CAGTAGGGGCTCAGAAAAGGGGG - Intronic
986160351 5:5222030-5222052 CAGTAGGACTTGTGAAATGATGG - Intronic
986573722 5:9191478-9191500 CAGTAGAACTTCACATAAGTAGG + Intronic
986648408 5:9940727-9940749 CTGTAGGACTTCAGGCAAGTTGG - Intergenic
989007650 5:36833122-36833144 CAGTAGCATTTCAGAGAAGGTGG + Intergenic
990151505 5:52823100-52823122 CAGAAGGATGTCAGGAAAGTCGG - Intronic
990205011 5:53419520-53419542 CAGTAGGACCACAGTAATGTGGG - Intergenic
993045691 5:82863828-82863850 CAGTGGTATTTCAGATAAGTGGG - Intergenic
997176484 5:131783254-131783276 CATTAGGACTTCAGAGAAAGAGG + Intronic
998652266 5:144134159-144134181 AAATAGGGCTCCAGAAAAGTAGG - Intergenic
999818931 5:155205014-155205036 CAGAAGGACTAGAAAAAAGTGGG + Intergenic
999858631 5:155621497-155621519 GAAAAGGATTTCAGAAAAGTTGG + Intergenic
1000412715 5:160950323-160950345 CAGTTGGCCTTGAGCAAAGTAGG + Intergenic
1000538741 5:162512367-162512389 CAGTAGAAATTCAGTAAACTTGG + Intergenic
1000814916 5:165909093-165909115 CATTAGGACCTCAGCAAAGTAGG - Intergenic
1003175411 6:3750297-3750319 GAGGAGGACTGCAGAAAAGAAGG + Intronic
1003510344 6:6774317-6774339 CAGTAAGAATTTAGAAAAGAGGG - Intergenic
1003867428 6:10376085-10376107 CAGTAGAACATAAGACAAGTTGG - Intergenic
1005137764 6:22590593-22590615 CAGTTGGACATCAGAAAAACTGG - Intergenic
1005321221 6:24656345-24656367 CAGAGGGAATTCAGAAAAATGGG + Intronic
1005786181 6:29248091-29248113 GAGCAGGTTTTCAGAAAAGTAGG + Intergenic
1007670639 6:43550404-43550426 CAGTAGGACTTCAGAAAAGTGGG - Intronic
1007882817 6:45186134-45186156 CAGTACCACTACAGCAAAGTGGG - Intronic
1008047444 6:46865767-46865789 CAGTAGAAGTTCAGAAAAGTGGG - Intronic
1012371307 6:98510684-98510706 GAGTAGTAATTCAGATAAGTTGG - Intergenic
1012690138 6:102300088-102300110 CAGTAGGGCTTCAGGGATGTGGG - Intergenic
1012908929 6:105097701-105097723 CAGGAGAGCTTCAGACAAGTGGG + Exonic
1013206227 6:107948335-107948357 CTGTATGACTTTAGGAAAGTTGG + Intronic
1013821798 6:114162781-114162803 CAGAAGGACTCCAGAAAGGAAGG - Intronic
1013925592 6:115468126-115468148 CAGGATGACTTAAGAAAACTTGG - Intergenic
1019947102 7:4338481-4338503 CAGCAGGTCTTCTGAAAGGTTGG + Intergenic
1020727455 7:11833081-11833103 CAGTAAGAGTTAAGAAAAATCGG - Intergenic
1021396925 7:20161203-20161225 CAGTAGAACTTCTGAAAATTTGG - Intronic
1022182259 7:27932243-27932265 CAGTTGGACTTGAGAACAGTTGG - Intronic
1024757156 7:52547799-52547821 GAGCAGGACTTCTGAAAGGTTGG - Intergenic
1028755496 7:94428824-94428846 CAGTAGGCATTCAGTAAAGTTGG - Intronic
1030201015 7:106904059-106904081 AAGTATGAAATCAGAAAAGTGGG - Intronic
1031726956 7:125251703-125251725 CAGTAGGAATTCAGAGTTGTAGG + Intergenic
1031820789 7:126498575-126498597 CAGTAAGTCTCCAGAAAAGTGGG + Intronic
1032597612 7:133257315-133257337 CAGCAGGTCAACAGAAAAGTAGG - Intronic
1032659913 7:133971246-133971268 CAGTAGGGCTTCAGAGTTGTTGG + Intronic
1034779245 7:153862117-153862139 CATTTGGACTTCAGAAAAGCAGG + Intergenic
1037873390 8:22521381-22521403 TGGTAGGACTGCAGACAAGTGGG + Intronic
1038287122 8:26215326-26215348 CATTAGAAATTCAGAAAAGGAGG + Intergenic
1039376433 8:37039088-37039110 CAATAGGTCTTTAGAAATGTAGG - Intergenic
1039445725 8:37630404-37630426 CAGCAGAACTTCAGGAAACTTGG - Intergenic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1042454237 8:68981887-68981909 CGGTAGGACTTGAGACAGGTTGG - Intergenic
1043663300 8:82774209-82774231 CAGAGGGACTTTAGAAAAATAGG - Intergenic
1043969397 8:86513605-86513627 TTGTGTGACTTCAGAAAAGTAGG + Intronic
1044019931 8:87093533-87093555 CAGTAGACTTTGAGAAAAGTAGG - Intronic
1046794366 8:118354704-118354726 CAGTAGAACTTCTGAAATGATGG - Intronic
1048004274 8:130406374-130406396 CAGTATGACTTATTAAAAGTTGG + Intronic
1049579303 8:143404185-143404207 AAGTAGGACATCAGAAAGGCGGG - Intergenic
1051208336 9:14713745-14713767 CAATTGGAGCTCAGAAAAGTTGG - Intergenic
1051210675 9:14739058-14739080 TATTAAGACTTCAGAAAAGAGGG + Intronic
1051736459 9:20204541-20204563 CAGTACGACATCAGCAAAGTTGG - Intergenic
1052474381 9:28939806-28939828 CAGAGGGAATTCAGAAAGGTGGG - Intergenic
1053561391 9:39199110-39199132 AAGTAGGAATTAAGAAATGTGGG + Intronic
1053825491 9:42019351-42019373 AAGTAGGAATTAAGAAATGTGGG + Intronic
1054135728 9:61419837-61419859 AAGTAGGAATTAAGAAATGTGGG - Intergenic
1054605073 9:67168006-67168028 AAGTAGGAATTAAGAAATGTGGG - Intergenic
1057790028 9:98118751-98118773 CAGTTGAGCTTCAGAAAAGGTGG - Intronic
1186476790 X:9863673-9863695 CAGTAGCTCTTCAGAAGCGTGGG + Intronic
1188028826 X:25241176-25241198 CAGTAGGTATTCAGTAATGTTGG + Intergenic
1188041044 X:25369924-25369946 CAGTAGGACTCCAGGGATGTGGG + Intergenic
1191626520 X:63276525-63276547 CAGTTGGACTGCAGATAAGCAGG - Intergenic
1192670898 X:73140122-73140144 CAGTAGGATTTCAGATCACTTGG - Intergenic
1194280831 X:91951992-91952014 CATTAGCACTTGTGAAAAGTAGG - Intronic
1196023102 X:111010850-111010872 GATTAGGAGTTCAGAGAAGTTGG - Intronic
1200286076 X:154823695-154823717 CAGTTGGACTCCAAAAGAGTGGG - Exonic
1200598424 Y:5176652-5176674 CATTAGCACTTGTGAAAAGTAGG - Intronic
1201901339 Y:19047932-19047954 GAGTAGGAGTTCAGCAGAGTAGG + Intergenic