ID: 1007671243

View in Genome Browser
Species Human (GRCh38)
Location 6:43555933-43555955
Sequence CACAACAAGGAGAGGTGATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007671243_1007671249 8 Left 1007671243 6:43555933-43555955 CCTCATCACCTCTCCTTGTTGTG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 1007671249 6:43555964-43555986 GCTGCCAAGAGAAAATGCCAAGG 0: 1
1: 0
2: 2
3: 33
4: 328
1007671243_1007671252 13 Left 1007671243 6:43555933-43555955 CCTCATCACCTCTCCTTGTTGTG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 1007671252 6:43555969-43555991 CAAGAGAAAATGCCAAGGGAAGG 0: 1
1: 0
2: 2
3: 55
4: 431
1007671243_1007671250 9 Left 1007671243 6:43555933-43555955 CCTCATCACCTCTCCTTGTTGTG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 1007671250 6:43555965-43555987 CTGCCAAGAGAAAATGCCAAGGG 0: 1
1: 0
2: 3
3: 27
4: 322
1007671243_1007671253 18 Left 1007671243 6:43555933-43555955 CCTCATCACCTCTCCTTGTTGTG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 1007671253 6:43555974-43555996 GAAAATGCCAAGGGAAGGACAGG 0: 1
1: 0
2: 5
3: 49
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007671243 Original CRISPR CACAACAAGGAGAGGTGATG AGG (reversed) Exonic
900144530 1:1152169-1152191 CAGACCAAGGAGAGGTGACGAGG - Intergenic
902172172 1:14620952-14620974 CAGGACAAGCAGAGATGATGAGG - Intronic
902538951 1:17138817-17138839 CTCAACAGGGAGAGGTGGGGAGG + Intergenic
903681689 1:25101833-25101855 CACAGGAAGGAGAGGGGAGGAGG - Intergenic
904036441 1:27561507-27561529 CACAGCAAGGAGGGGTGCAGGGG + Intronic
905637486 1:39564562-39564584 CACATCATTGAGAAGTGATGTGG + Intronic
906352750 1:45078299-45078321 CCCAAGAAGGACAGGTGTTGCGG - Intronic
907556239 1:55346383-55346405 CACACCAAGGAGTGGAGCTGGGG + Intergenic
910140295 1:84019858-84019880 CACAACCAGGACACATGATGTGG + Intergenic
912654056 1:111469789-111469811 CACAAGAAGGAGAGGAGAACTGG + Intergenic
913239795 1:116820064-116820086 CACAGCAAGGAGAGGTGTACTGG - Intergenic
914926675 1:151894710-151894732 CTCAAGACGGAGAGGTGATGAGG + Intronic
915004510 1:152623671-152623693 TTCAACAAGGAGAGGGGAGGAGG - Intergenic
915614621 1:157027524-157027546 CACATCAAGGAGAGTTAATAAGG + Intronic
916742691 1:167660346-167660368 CCCAGGAAGGAGAAGTGATGGGG - Intronic
917143146 1:171857934-171857956 CACAAAAAGAAGAGGCCATGTGG + Intronic
917571074 1:176266046-176266068 CACAGCAAGGAGAGGGCCTGAGG - Intergenic
918715438 1:187780364-187780386 GACATCAAGAAGAGGTGATTGGG - Intergenic
919526593 1:198660545-198660567 GACAACAGGTAGAGGTTATGAGG + Intronic
920216062 1:204362174-204362196 TACAGCAAGGACAGGTGAGGCGG + Intronic
920631195 1:207654124-207654146 AACAGCAGTGAGAGGTGATGGGG - Intronic
921366003 1:214374522-214374544 CACAACAAGCAGTGCTGCTGAGG + Intronic
1062942057 10:1429889-1429911 AGCAACAAGGAAAGGAGATGAGG - Intronic
1064345856 10:14532299-14532321 CATAACACGGGGAGGTGCTGGGG - Intronic
1064430713 10:15267790-15267812 CAGAACACGGAGCGGTGAGGAGG + Intronic
1065620490 10:27576145-27576167 CAGAGGTAGGAGAGGTGATGTGG - Intergenic
1065963889 10:30755122-30755144 CCCTTCAAGGAGGGGTGATGAGG + Intergenic
1068759047 10:60687557-60687579 CACAACAAGCATTGGTGAGGAGG + Intronic
1068940024 10:62671410-62671432 GACAGCAAGGAGGGGTGAGGAGG - Exonic
1071570192 10:86692472-86692494 CACAGCAAGGAAAGCTGCTGGGG - Intronic
1072866707 10:99069900-99069922 CATAACAAGGAGAGGGAAAGTGG + Intronic
1073458001 10:103649271-103649293 CACAGCATGGAGGGGTGATTAGG - Intronic
1073751549 10:106533838-106533860 CTCAACAAGGAGCAGTAATGAGG - Intergenic
1073904812 10:108265859-108265881 CACAACCAGGAGATGAGAGGTGG + Intergenic
1074820969 10:117178145-117178167 ATCAACAAGGAGGTGTGATGTGG - Intergenic
1076458919 10:130625063-130625085 CACATCTTGGAGAGGTGAAGTGG + Intergenic
1077994738 11:7443400-7443422 CACAGCAAGGATAGGGCATGGGG + Intronic
1078324270 11:10366845-10366867 CACGACAAGGACAGATGTTGTGG - Intronic
1078462147 11:11522187-11522209 CAGAATGAGGAGAGGTCATGTGG - Intronic
1080201796 11:29680256-29680278 CACAATAAGGACAGATGAAGAGG + Intergenic
1081995236 11:47359584-47359606 CACAACAAGGCGTTGGGATGGGG + Intronic
1082782845 11:57300651-57300673 CACAACAAGGAGACGTGATAGGG + Intronic
1084580534 11:70020321-70020343 CACCACCAGCAGAGATGATGAGG - Intergenic
1092055324 12:5504089-5504111 CCCAACAAGGAGAGGTGGGGAGG + Intronic
1092733118 12:11553114-11553136 CACAACAAGGAAACTTGGTGGGG + Intergenic
1092835423 12:12483590-12483612 CACAACATAGGGAGGTGATTAGG - Intronic
1095289610 12:40462887-40462909 CCTAACAAGGAGAGGAGAGGAGG + Intronic
1096386478 12:51198101-51198123 CACAAGAAGGAGAGGGGGTTGGG + Intronic
1096581097 12:52585842-52585864 GACAACAGGGAGAGGAAATGGGG + Exonic
1097923652 12:65104721-65104743 AACAAGAAGAAGAGGTGGTGGGG - Intronic
1099431567 12:82592328-82592350 CCCAACATGGGGAGGTGATAGGG - Intergenic
1101047664 12:100826957-100826979 CATTACAGGGAGAGATGATGGGG - Intronic
1101623495 12:106415285-106415307 CACTACAGTGAGATGTGATGTGG + Intronic
1101658705 12:106747263-106747285 CAAAACAAAGACAGGGGATGGGG + Intronic
1101724799 12:107379931-107379953 CACAACACTGTGAGGTGTTGGGG - Intronic
1102572466 12:113835473-113835495 CACGAAAAGGAGAGGTGTGGGGG + Intronic
1102908633 12:116696129-116696151 AACAACCAGGGGAGGTGATGGGG - Intergenic
1104337383 12:127912213-127912235 CACAACAAGGAGAGGTCTTCTGG - Intergenic
1106046554 13:26147303-26147325 AAAAACAAAGAGAGGTGATGGGG + Intronic
1106291083 13:28362823-28362845 CCCAAGGAGGAGAGGAGATGGGG + Intronic
1107137022 13:36956323-36956345 CACAACAAGCACTGGTGAGGAGG + Intronic
1108541252 13:51448991-51449013 CACAACAAGGATAAATGATTAGG - Intronic
1109590275 13:64470578-64470600 AACAACAAGAATAGGTAATGTGG + Intergenic
1111415829 13:87942681-87942703 CAGAGCAAGGAGAGATGATGAGG - Intergenic
1112025331 13:95406293-95406315 CACACTAAGGAGAGGCCATGAGG - Intergenic
1112426770 13:99309437-99309459 CAGATGAAGAAGAGGTGATGGGG + Intronic
1112763894 13:102720236-102720258 GTCAGCAAGGAGAGGTGATATGG + Intergenic
1113748924 13:112765210-112765232 CACAGACAGGAGAGGTGAGGAGG + Intronic
1114285924 14:21243095-21243117 CTCAAAAAGGAGAGGTGGGGGGG + Intronic
1114648394 14:24268329-24268351 CAAAACAAGGAGAGGGGCTCTGG - Intronic
1116365539 14:44058226-44058248 CACACAAAGAAGAGGTCATGTGG - Intergenic
1121422244 14:93824179-93824201 AGCAACAAGGGGAGGTGATGAGG - Intergenic
1123784993 15:23662686-23662708 GTCTACAAGGAGATGTGATGTGG + Intergenic
1128578224 15:68790623-68790645 CACCCCAAGGAGTGGTTATGGGG - Intronic
1130047393 15:80456304-80456326 CACAAAAAGAAGAGGAGATGGGG - Intronic
1132040939 15:98524168-98524190 CACAACAACGAGAGGAGCTGGGG + Intergenic
1133699308 16:8294310-8294332 CACAAAAAGGAGAGGAGACTTGG - Intergenic
1133726444 16:8542102-8542124 CTCAACCAGGAAGGGTGATGGGG - Intergenic
1136499742 16:30664411-30664433 GAGAACAAGGAGGGGTGGTGGGG - Exonic
1138371104 16:56526912-56526934 GACATCCAGGAGAGATGATGGGG - Intergenic
1141727975 16:85802296-85802318 CACAGCAAGGTGAGGTGACAGGG - Intronic
1147258229 17:39194721-39194743 CACATCCAGAAGAGGTCATGGGG + Intronic
1147647662 17:42043457-42043479 CTTGACAAGGAGAGTTGATGGGG + Intronic
1147699373 17:42383025-42383047 CAGAGGAAGGAGAGGTTATGAGG - Intronic
1147699646 17:42384937-42384959 CAGAGAAAGGAGAGGTTATGAGG - Intronic
1147950703 17:44106178-44106200 AAAAACAAGAAGAGGGGATGAGG + Intronic
1148544853 17:48509947-48509969 AAAAACAAGGCGAGGTGCTGTGG + Intergenic
1149818772 17:59753301-59753323 CACAATTAGGAGAAGTGATGGGG + Intronic
1150737751 17:67754780-67754802 CACAAGAAGGAGAGGAGGTAGGG - Intergenic
1152100066 17:78296203-78296225 CAGAAAAGGGAGAGGTGAAGAGG + Intergenic
1153942704 18:9991404-9991426 CATAAAGAGGAGAGGCGATGTGG - Intergenic
1154470295 18:14693777-14693799 CACTACCAGGAGAGGTGTAGTGG + Intergenic
1155705362 18:28803657-28803679 CACCTTAAGGAGAGATGATGGGG + Intergenic
1156054235 18:32979094-32979116 AACAACAAATGGAGGTGATGAGG + Intronic
1157141934 18:45117479-45117501 TAGTACAAGGAGAGGTGATGAGG + Intergenic
1157487995 18:48102691-48102713 CAAAACCAGGAGATGTGATGAGG + Intronic
1157828306 18:50832617-50832639 CACACCCAGGAGATGTGCTGTGG + Intergenic
1158527346 18:58227067-58227089 CACAGCAAGGAGGACTGATGTGG - Intronic
1161623540 19:5312072-5312094 CACAACCAGGAGATGTCATGTGG - Intronic
1162501046 19:11054063-11054085 CACAACAAGGAAACGTGTTTAGG + Intronic
1162658476 19:12150827-12150849 GACAACAAGGAGTGGTCATGAGG - Intronic
1163013572 19:14440417-14440439 GGGAACAAGGAGAGGAGATGGGG + Intronic
1165053777 19:33160680-33160702 CACAACAGGGTGACATGATGGGG + Intronic
1166364062 19:42269653-42269675 TGTGACAAGGAGAGGTGATGGGG + Intronic
1166516741 19:43452802-43452824 CAAAACAAGGGAAGGAGATGAGG + Intergenic
1167575892 19:50317214-50317236 TACAAAAAGGAGAGGTGGGGGGG + Intronic
1167716198 19:51144226-51144248 CACCACAGGGAAAGGTCATGGGG + Intronic
925278504 2:2667220-2667242 CACAACCAGGCTAGGAGATGAGG + Intergenic
926147583 2:10406057-10406079 GACAGCAAGGAGGGGTGAAGGGG - Intronic
926333777 2:11848323-11848345 CCCAATAAGGTAAGGTGATGTGG - Intergenic
926355279 2:12035774-12035796 GATTTCAAGGAGAGGTGATGAGG - Intergenic
926429267 2:12769156-12769178 TACAAGAAGGAGAGATGAGGGGG - Intergenic
928175914 2:29034240-29034262 CACAGCAGGGAGAGAGGATGTGG - Intronic
928651608 2:33410006-33410028 AACAACCTGGAGAGGGGATGAGG + Intergenic
930301826 2:49626060-49626082 CATAATAATGAGAGGAGATGTGG + Intergenic
930643931 2:53883565-53883587 CACAATAAAGAAAGGTAATGTGG + Intronic
931127300 2:59292373-59292395 CAGACCAAGGACAGGTGCTGGGG - Intergenic
932357768 2:71080605-71080627 CACATTTAGGAGATGTGATGAGG + Intergenic
932370177 2:71180601-71180623 CACATTTAGGAGATGTGATGAGG + Intergenic
932621290 2:73266047-73266069 CAAAAGATGGAGAGGAGATGGGG + Intronic
934919358 2:98330376-98330398 ATTAACAAGGAGAGGAGATGTGG - Intergenic
935176729 2:100655422-100655444 CACACCGAGGAAAGGGGATGGGG + Intergenic
937055434 2:118931200-118931222 AACCAAAAAGAGAGGTGATGTGG - Intergenic
938565455 2:132514479-132514501 CACCTCAAGGAGGGGTGAGGTGG - Intronic
939870511 2:147521162-147521184 GACAACCATGAGAGGTGATTAGG + Intergenic
940333187 2:152497958-152497980 CAAACCAGGGAGAGGTCATGTGG - Intronic
941340009 2:164295354-164295376 CTCATCAAGGAGAAGTGATTGGG - Intergenic
942394885 2:175536649-175536671 GAGAACCAGGAGAGCTGATGGGG - Intergenic
944508746 2:200443572-200443594 CAAAGCAAGGAGAGGAGAAGAGG - Intronic
946194266 2:218023784-218023806 CAAAACAAGGAGGGCTGGTGGGG - Intergenic
947113804 2:226747862-226747884 CACAACCAGGAAAGGGGTTGGGG + Intronic
947216880 2:227757949-227757971 CAGAAAAAGGAGCAGTGATGAGG - Intergenic
1169737659 20:8854454-8854476 GAGAAAAAGGAGAGGTGTTGGGG - Intronic
1170012946 20:11747286-11747308 AGCAACAAGGAGAGCTGAAGTGG + Intergenic
1170987480 20:21271855-21271877 CACCACATGGAGAGGACATGTGG + Intergenic
1171948164 20:31396870-31396892 CAGAACTGGGAGAGGAGATGGGG - Intergenic
1172622918 20:36331418-36331440 CACAGCAAAGGGAGGTAATGAGG - Intronic
1176804198 21:13464089-13464111 CACTACCAGGAGAGGTGTAGTGG - Intergenic
1178490318 21:33046627-33046649 GAAAACAAGGAAAGGTGATATGG + Intergenic
1179426714 21:41285546-41285568 CACACCAAGGAAAGGCTATGTGG - Intergenic
1180834071 22:18921092-18921114 CACCACAAGGAGAGGGGGTCTGG - Intronic
1180853554 22:19033247-19033269 CACAAGATGGACAGGTGGTGAGG - Intergenic
1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG + Intergenic
1183171440 22:36191225-36191247 CACAACAAGGACACCTGAAGTGG + Exonic
1184206032 22:43003904-43003926 CACAAAAGGGAGAGCTGCTGGGG - Intronic
1185304780 22:50108746-50108768 CACACCCCGGAGAGGTGACGTGG + Exonic
1203284159 22_KI270734v1_random:146390-146412 CACCACAAGGAGAGGGGGTCTGG - Intergenic
949476803 3:4454424-4454446 CACAACAACAAGTGCTGATGAGG + Intronic
949617621 3:5771408-5771430 TACAACAAGGAGAGATGGTCTGG - Intergenic
952037567 3:29221154-29221176 CACAACAGGGACAGGTGTAGAGG - Intergenic
952194066 3:31054047-31054069 CACACCAAGGAGTGGAGGTGCGG + Intergenic
955028742 3:55196077-55196099 CACTACTAGGTGATGTGATGAGG + Intergenic
955555827 3:60136203-60136225 CAACACAAGGAGAGGAGAAGAGG + Intronic
956647239 3:71468358-71468380 CACACCAAGGAGAAATGTTGGGG - Intronic
956788744 3:72664092-72664114 CAACACAAAGAGAGCTGATGAGG + Intergenic
960089812 3:113627838-113627860 CACAGGAAGGAGAGGGGCTGCGG + Exonic
960463055 3:117960377-117960399 CAAACCAAGGAGAGCAGATGTGG + Intergenic
961565846 3:127762878-127762900 CACAGACAGGAGATGTGATGGGG + Intronic
961944408 3:130671070-130671092 CACACCAAGTAAAGGGGATGGGG + Intronic
963146954 3:142003713-142003735 CACAAGAAGGAGAGGCGATTTGG - Intronic
966486068 3:180471384-180471406 CACCACAAGGACAGGTGCAGTGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966924654 3:184636414-184636436 CTCAGCAAGGAGAGGAGCTGTGG + Intronic
969937965 4:10701752-10701774 CACAGAAAGGTGAGGTGATATGG + Intergenic
970460033 4:16265489-16265511 CACAAGAAGGCTTGGTGATGGGG - Intergenic
972423336 4:38910568-38910590 TAGAACAGGAAGAGGTGATGAGG + Intronic
973580958 4:52343750-52343772 AGCAAGAAGGAGTGGTGATGGGG - Intergenic
975215424 4:71748318-71748340 CACAAGAAAGACAGGTGGTGGGG + Intronic
977555874 4:98486904-98486926 CACAACAAGGCACGGGGATGTGG + Intronic
981527144 4:145718201-145718223 CACTACAAGGAGGTGTTATGTGG + Intronic
982831520 4:160067133-160067155 CACAAATAAGAGAGTTGATGTGG - Intergenic
982994230 4:162320264-162320286 CACAACAATGTGGGGTGGTGGGG - Intergenic
984483576 4:180337047-180337069 CACAAAAGGGAGAGGTTATAAGG + Intergenic
985141043 4:186840709-186840731 CACCAAAAAGAGCGGTGATGGGG - Intergenic
986341231 5:6791104-6791126 CAGAGCAGGGAGAGGAGATGGGG - Intergenic
987646106 5:20674704-20674726 CAAAGGAAGGAGAGGTGATTGGG - Intergenic
988529032 5:32011199-32011221 CACAAAAAGGCTAGGTGCTGTGG + Intronic
992699716 5:79329765-79329787 AACTACAAGGAGATGTGATTTGG + Intergenic
994198868 5:96949952-96949974 CAGAAAAAGGAAAGGTGAGGGGG - Intronic
994271263 5:97780131-97780153 CACAATAAGAAGAGGTCATGGGG - Intergenic
996774087 5:127116000-127116022 AACAGCCAGGAGAGGAGATGGGG - Intergenic
997361757 5:133299717-133299739 CACAAGGAGGAGCGGTGATGGGG - Intronic
997608579 5:135194119-135194141 CACAAAGCCGAGAGGTGATGAGG + Intronic
998882443 5:146657183-146657205 CACAGCAAGGGGAGGCCATGGGG + Intronic
999694974 5:154180639-154180661 CAAAACACAGAGAGGTGGTGGGG - Intronic
1000093594 5:157951306-157951328 TACAGCAAGGCGAGGTGCTGTGG + Intergenic
1000810945 5:165860307-165860329 CAAAACAAACAGAGGTGATCAGG + Intergenic
1004045848 6:12021950-12021972 CACAACCAGGCCAGGTGAAGTGG - Intronic
1005195970 6:23284386-23284408 CTCAACAAGGACTGGTAATGTGG - Intergenic
1006743279 6:36324123-36324145 AACAGCAAGGAGAGGAGGTGAGG - Exonic
1007243374 6:40442817-40442839 CACAACCAGGAGGGGTGTTCAGG - Intronic
1007503772 6:42318562-42318584 CCCAAGAAGCAGAGGTAATGTGG + Intronic
1007626918 6:43251897-43251919 CACAAGAAGGAGAGAGTATGTGG - Intronic
1007671243 6:43555933-43555955 CACAACAAGGAGAGGTGATGAGG - Exonic
1007788325 6:44294830-44294852 CACAGAAAGGAGAGGAGGTGGGG + Intronic
1009485688 6:64219029-64219051 TACAACAGGGAAAGGTGTTGTGG + Intronic
1010529549 6:76950707-76950729 TACAACAATGAGAGGAGATAGGG + Intergenic
1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG + Intergenic
1015489098 6:133805217-133805239 GACAACAGTGAGAGGTGATCAGG + Intergenic
1016210794 6:141531388-141531410 CACAAAAGGGAGGGGTGCTGAGG + Intergenic
1016900617 6:149097288-149097310 CAGACCAAGTAGAGGTGATGAGG + Intergenic
1018087776 6:160319797-160319819 CAAAACAAGGATAGATGATCAGG + Intergenic
1018839586 6:167508241-167508263 GACAGGAAGGAGAGGGGATGGGG - Intergenic
1018839883 6:167509111-167509133 GACAGGGAGGAGAGGTGATGGGG - Intergenic
1018839907 6:167509192-167509214 GACAGGAAGGAGAGGTGATGGGG - Intergenic
1019637410 7:2083456-2083478 CACAGCACGGAGAGGAGGTGCGG + Intronic
1019738173 7:2660572-2660594 CAGCACAAGGGGAGGGGATGGGG - Intronic
1019771571 7:2886739-2886761 CGCAACAAGGAGGGGTGACCAGG - Intergenic
1021790135 7:24196350-24196372 CACAACAAAGAGAGGGGGAGAGG - Intergenic
1022587965 7:31633873-31633895 GAGAAAAAGCAGAGGTGATGGGG - Intronic
1023365866 7:39462651-39462673 CACAACAATGAGAGCTTTTGAGG + Intronic
1023570925 7:41571128-41571150 CACAAGAAGGAGTGATTATGTGG + Intergenic
1024705107 7:51948430-51948452 CACAACAAAGTGAGGTGACCAGG + Intergenic
1024750519 7:52459823-52459845 CACACCAAGGCGAGGTCACGTGG - Intergenic
1026618375 7:71928144-71928166 CACAAGAAAGATTGGTGATGGGG - Intronic
1026645009 7:72159958-72159980 CACAAAAAGAAGAGCAGATGTGG + Intronic
1028232551 7:88323177-88323199 CACAAAAAGCAGAGGAGATCAGG - Intergenic
1032648434 7:133851650-133851672 CAAAAGAAAGAGAGGTCATGTGG + Intronic
1032952361 7:136929514-136929536 CAAAAGAAGGAGAGGTGAAAAGG - Intronic
1033652669 7:143354443-143354465 GACGACAGGAAGAGGTGATGTGG + Exonic
1034378446 7:150667180-150667202 AACAAAATGGAGAGGTGCTGTGG + Intergenic
1036124309 8:6049019-6049041 CACAAGAAGACAAGGTGATGGGG + Intergenic
1036450831 8:8865922-8865944 CTGAACAAGGAGAGGTGTGGAGG - Intronic
1036722428 8:11189004-11189026 AACAGCCAGGAGAGGGGATGAGG - Intronic
1036918541 8:12829651-12829673 CAATGCAAGGAGAGGTTATGTGG - Intergenic
1037151917 8:15647029-15647051 GAGAAGAAGAAGAGGTGATGGGG - Intronic
1038396229 8:27247543-27247565 CACAACCAGGCCAGGTGCTGGGG - Intronic
1038727035 8:30090803-30090825 CAAAACAAGAAAAGGTGTTGTGG + Intergenic
1039442316 8:37603518-37603540 CACAAAATGGACAGGTGAGGGGG + Intergenic
1039891655 8:41689839-41689861 CACACCAAGGAGAGCTGCTAAGG - Intronic
1042669134 8:71241752-71241774 CTCATCAGGGAGAAGTGATGTGG - Intronic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1044457282 8:92403174-92403196 CACAAATTGGAGAGATGATGTGG + Intergenic
1044879700 8:96711583-96711605 GGCAACAAGGAGAAGTGCTGAGG + Intronic
1045051214 8:98327619-98327641 CACAACACAGAGATGTGGTGGGG - Intergenic
1051209201 9:14723678-14723700 TAAAACAAGGGGAGATGATGTGG - Intergenic
1052840582 9:33288957-33288979 CACAACAAGCAGATGTTAAGAGG - Intergenic
1052926883 9:34024571-34024593 CACAACAATCACAGGGGATGGGG + Intronic
1055162650 9:73149473-73149495 CAAAACAAGGAGAGGAAATATGG - Intergenic
1055339844 9:75269580-75269602 CACAAAAAGGAGAAGTGACTGGG - Intergenic
1056462744 9:86823988-86824010 CACAACAACTGGAGGTGATGTGG + Intergenic
1057575792 9:96241478-96241500 CACAACAGGAAGAGGTTATGAGG - Intronic
1062347235 9:136120616-136120638 CACAGCAAGGAGCGGGGCTGTGG - Intergenic
1188720988 X:33523392-33523414 GAGAAACAGGAGAGGTGATGGGG + Intergenic
1189233742 X:39471922-39471944 CAAACCAAGGTGAGGAGATGAGG + Intergenic
1192261438 X:69508031-69508053 AACAAGAAGTAGAGGTGATAAGG - Intronic
1193678012 X:84481474-84481496 CACATCACTGAGAGGTTATGTGG + Intronic
1195704550 X:107729540-107729562 GGCAAAAAGGAGTGGTGATGAGG - Intronic
1197757377 X:130005304-130005326 ATCAACGAGGAGAGGTGAGGAGG + Exonic
1198755021 X:139973671-139973693 GACCACAGGGAGAGGTCATGTGG + Intergenic
1201768569 Y:17595832-17595854 CACAACAAGGAAAGGAGAGAGGG - Intergenic
1201832985 Y:18310153-18310175 CACAACAAGGAAAGGAGAGAGGG + Intergenic