ID: 1007673525

View in Genome Browser
Species Human (GRCh38)
Location 6:43576155-43576177
Sequence GACAGCGCGCCCGCTGCGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 21}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007673525_1007673528 -6 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673528 6:43576172-43576194 GCTGTCAGACCTCAGTCTGGCGG 0: 1
1: 0
2: 3
3: 18
4: 124
1007673525_1007673530 6 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673530 6:43576184-43576206 CAGTCTGGCGGCTGCATTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 193
1007673525_1007673527 -9 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673527 6:43576169-43576191 CGCGCTGTCAGACCTCAGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 58
1007673525_1007673531 7 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673531 6:43576185-43576207 AGTCTGGCGGCTGCATTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007673525 Original CRISPR GACAGCGCGCCCGCTGCGAA GGG (reversed) Exonic
904430743 1:30462545-30462567 AACAACGTGCCCGCTGTGAAGGG - Intergenic
1072970022 10:100009679-100009701 CACAGCGCCGCCGCTGGGAAAGG + Intronic
1078011084 11:7573710-7573732 CACAGTGGGCCCGCTGAGAAGGG - Intronic
1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG + Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1150228314 17:63535695-63535717 GACAGCGCGGCTGCTGCGGCTGG + Exonic
1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG + Intergenic
925187584 2:1859836-1859858 GACAGCGCGCCGGATGAGAGGGG + Intronic
948465310 2:238149242-238149264 CACAGAGGGCCCACTGCGAAGGG + Intronic
948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG + Intergenic
961493713 3:127275424-127275446 GACAGCCAGACCTCTGCGAAGGG - Intergenic
966749485 3:183308529-183308551 GAAAGAGCGCTCGCTGTGAAGGG + Intronic
969239237 4:5888338-5888360 GTCAGCGCGCCCGCTGGGAGCGG - Intronic
1007673525 6:43576155-43576177 GACAGCGCGCCCGCTGCGAAGGG - Exonic
1008030535 6:46688743-46688765 GATAGCGCTCCAGCAGCGAACGG - Exonic
1012908891 6:105097445-105097467 GACGCCACGCCCGCTGGGAAGGG + Exonic
1019280736 7:198731-198753 GACAGCGCACCTGCTGGGCAGGG + Intronic
1025261947 7:57425727-57425749 GACAGAGTGCTCGCTCCGAAGGG - Intergenic
1027260631 7:76462087-76462109 GACAGGGTGCCGGGTGCGAAAGG + Intronic
1027312010 7:76960200-76960222 GACAGGGTGCCGGGTGCGAAAGG + Intergenic
1031695310 7:124844448-124844470 GCCACCGCGCCCGGTGCCAATGG - Intronic
1049286267 8:141776958-141776980 GACAGAGCCCCCACTGCGAGTGG + Intergenic
1051174184 9:14347057-14347079 GACAACCCGCCCGGCGCGAAGGG + Intronic
1200145942 X:153926589-153926611 GCCAGCGGCCCCGCTGTGAATGG - Intronic