ID: 1007673525

View in Genome Browser
Species Human (GRCh38)
Location 6:43576155-43576177
Sequence GACAGCGCGCCCGCTGCGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 21}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007673525_1007673527 -9 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673527 6:43576169-43576191 CGCGCTGTCAGACCTCAGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 58
1007673525_1007673528 -6 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673528 6:43576172-43576194 GCTGTCAGACCTCAGTCTGGCGG 0: 1
1: 0
2: 3
3: 18
4: 124
1007673525_1007673531 7 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673531 6:43576185-43576207 AGTCTGGCGGCTGCATTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 110
1007673525_1007673530 6 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673530 6:43576184-43576206 CAGTCTGGCGGCTGCATTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007673525 Original CRISPR GACAGCGCGCCCGCTGCGAA GGG (reversed) Exonic