ID: 1007673527

View in Genome Browser
Species Human (GRCh38)
Location 6:43576169-43576191
Sequence CGCGCTGTCAGACCTCAGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007673522_1007673527 3 Left 1007673522 6:43576143-43576165 CCGCGTCAACGGCCCTTCGCAGC 0: 1
1: 0
2: 0
3: 1
4: 90
Right 1007673527 6:43576169-43576191 CGCGCTGTCAGACCTCAGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 58
1007673526_1007673527 -10 Left 1007673526 6:43576156-43576178 CCTTCGCAGCGGGCGCGCTGTCA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1007673527 6:43576169-43576191 CGCGCTGTCAGACCTCAGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 58
1007673525_1007673527 -9 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673527 6:43576169-43576191 CGCGCTGTCAGACCTCAGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 58
1007673520_1007673527 16 Left 1007673520 6:43576130-43576152 CCGCGGTGCGCAGCCGCGTCAAC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1007673527 6:43576169-43576191 CGCGCTGTCAGACCTCAGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007673527 Original CRISPR CGCGCTGTCAGACCTCAGTC TGG Exonic
901757551 1:11450597-11450619 CTGGCTTTCAGACCTCAGTTAGG + Intergenic
903378741 1:22882652-22882674 CCCACTGTGAGACCTCAGGCAGG + Intronic
905646105 1:39626099-39626121 GGGGCGGTCAGACCCCAGTCAGG - Exonic
919466155 1:197923026-197923048 CGCTCTCTCAGACCTCCGTTGGG + Intronic
920251828 1:204627225-204627247 CTCGCTGTGGGACCTCAGTCCGG - Intronic
922450835 1:225735937-225735959 CGCGCTGTCCGACCTCAGCGAGG - Intergenic
1067286660 10:44912146-44912168 CCTGCAGTCAGACCTCAGACAGG - Intronic
1076842454 10:133052482-133052504 CGCGCCCTCAGCCCTCAGGCTGG + Intergenic
1077107224 11:847503-847525 CACAGTGTCAGAGCTCAGTCGGG - Intronic
1078411180 11:11120101-11120123 CCCTCTCTCAGACCTCAGGCTGG + Intergenic
1084572612 11:69968658-69968680 CGCTCTGTCATTCCTCAGGCAGG + Intergenic
1106815895 13:33406829-33406851 CGCCTTGTGAGACCTCAGCCAGG + Intergenic
1113972074 13:114198818-114198840 CGCGCTGTCACGCCTCAGCGGGG - Intergenic
1113972116 13:114198974-114198996 CGCGCTGTCACGCCTCAGTGGGG - Intergenic
1113972159 13:114199130-114199152 CGCGCCGTCACGCCTCAGTGGGG - Intergenic
1113972213 13:114199325-114199347 CGCGCCGTCACGCCTCAGTGGGG - Intergenic
1113972271 13:114199520-114199542 CGCGCCGTCACGCCTCAGTGGGG - Intergenic
1122267999 14:100555599-100555621 CGGGCTGTGTGACCTCAGACAGG - Intronic
1123104720 14:105835433-105835455 CGGGCTGTCCAACCTCAGACTGG - Intergenic
1129468243 15:75736234-75736256 AGCGCTGTGTGACCTCAGGCAGG - Intergenic
1132072260 15:98788673-98788695 AGAGCTGTCAGACCTCAGCAGGG - Intronic
1133091027 16:3403859-3403881 CCCGAAGTCAGACCCCAGTCAGG + Intronic
1136233294 16:28900410-28900432 CCTGGTGTCAGACCTCAGTGGGG - Intronic
1139613145 16:68073138-68073160 CGCACTTCGAGACCTCAGTCAGG + Intronic
1140562433 16:75998828-75998850 AGCGATGTCAGAGCACAGTCAGG + Intergenic
1149489714 17:57074956-57074978 GAAGCTGTCAGACCTAAGTCTGG - Intergenic
1151925957 17:77197034-77197056 CTGGCTGTGAGACCTCAGGCAGG - Intronic
1152511640 17:80793687-80793709 CGCGCTGGCAGGGCTCTGTCCGG - Intronic
1160756521 19:760068-760090 GGGGCTGTCTGACCTCAGCCTGG - Intronic
1161075256 19:2282211-2282233 CCCACTGTCAGACCGCAGCCCGG + Intronic
1161794533 19:6378822-6378844 AGGATTGTCAGACCTCAGTCAGG + Intronic
1166403164 19:42499132-42499154 CCTGCTGTGAGACCTCAGGCAGG - Intergenic
930529346 2:52571597-52571619 CCCGCTGTCATACATCACTCAGG + Intergenic
934047920 2:88187169-88187191 AGCGCCTTCAGACCTCAGGCAGG - Intergenic
936601587 2:113901312-113901334 CGCGCTGTCGCACTTCAGCCTGG + Intronic
945963162 2:216157064-216157086 CGTGCTGTCTGTCCTCAGTCTGG - Intronic
1168889825 20:1287817-1287839 AGAGCTGTCAAGCCTCAGTCCGG - Intronic
1171163418 20:22949553-22949575 CGCCCAGTCAAACCACAGTCTGG + Intergenic
1175399430 20:58692455-58692477 CGCCCGGTCAGGCCTCAGGCTGG - Intronic
1178437507 21:32573018-32573040 AACGCCGTCAGACCTCAGTCTGG - Intergenic
953989888 3:47475878-47475900 CGCGCTCTCGGCCCGCAGTCCGG + Exonic
961013527 3:123450182-123450204 GGAGCTGTCAGACTACAGTCCGG + Intergenic
967149657 3:186637022-186637044 CTGGCTGTAAGACCTCAGGCAGG + Intronic
974026713 4:56739201-56739223 TGCTTTGTCAGACCTCAGACAGG - Intergenic
986557480 5:9025965-9025987 CCTGCTGTCAGTCCTGAGTCTGG + Intergenic
989465396 5:41748704-41748726 CTCACTGTCACACCTCAGTGAGG + Intronic
994010325 5:94894804-94894826 CGACCTGTCAGCCCTCAGTAGGG - Exonic
995131078 5:108631133-108631155 CTTGCTGTCAGACATCAATCTGG + Intergenic
1002139948 5:177132631-177132653 CGCGCTGTCAGGCTGCAGCCCGG + Intergenic
1007673527 6:43576169-43576191 CGCGCTGTCAGACCTCAGTCTGG + Exonic
1010199397 6:73269420-73269442 CACGCTGTCACCTCTCAGTCAGG + Intronic
1018796270 6:167187711-167187733 AACGCCGTCAGACCTTAGTCAGG + Intronic
1018820049 6:167367347-167367369 AACGCCGTCAGACCTCAGTCAGG - Intronic
1021055635 7:16042969-16042991 CACGCTTTCAGTCCTCAGTATGG - Intergenic
1026486964 7:70830097-70830119 CGCCCGGTCTGACCTCAGCCTGG + Intergenic
1047410499 8:124620852-124620874 CGCTCTATCAGAGCTCAGTGAGG - Intronic
1048360897 8:133696497-133696519 CCCTCTGTGAGACCTCAGTAGGG - Intergenic
1049383549 8:142329673-142329695 TGCACGGTCAGACCTCAGTGAGG - Intronic
1053566504 9:39258138-39258160 CCCTCTGCCAGACCTCAGGCAGG + Intronic
1053832283 9:42095998-42096020 CCCTCTGCCAGACCTCAGGCAGG + Intronic
1054130642 9:61360874-61360896 CCCTCTGCCAGACCTCAGGCAGG - Intergenic
1054598265 9:67091422-67091444 CCCTCTGCCAGACCTCAGGCAGG - Intergenic
1056960581 9:91118744-91118766 GGTGCTGCCAGACCTCAGTGTGG - Intergenic
1058263839 9:102873139-102873161 CTTGCTGTCAGACCTCTGTATGG - Intergenic
1062483295 9:136762364-136762386 CTTGCTGTCAGCCCTCAGGCTGG - Intronic