ID: 1007673528

View in Genome Browser
Species Human (GRCh38)
Location 6:43576172-43576194
Sequence GCTGTCAGACCTCAGTCTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007673525_1007673528 -6 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673528 6:43576172-43576194 GCTGTCAGACCTCAGTCTGGCGG 0: 1
1: 0
2: 3
3: 18
4: 124
1007673520_1007673528 19 Left 1007673520 6:43576130-43576152 CCGCGGTGCGCAGCCGCGTCAAC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1007673528 6:43576172-43576194 GCTGTCAGACCTCAGTCTGGCGG 0: 1
1: 0
2: 3
3: 18
4: 124
1007673526_1007673528 -7 Left 1007673526 6:43576156-43576178 CCTTCGCAGCGGGCGCGCTGTCA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1007673528 6:43576172-43576194 GCTGTCAGACCTCAGTCTGGCGG 0: 1
1: 0
2: 3
3: 18
4: 124
1007673522_1007673528 6 Left 1007673522 6:43576143-43576165 CCGCGTCAACGGCCCTTCGCAGC 0: 1
1: 0
2: 0
3: 1
4: 90
Right 1007673528 6:43576172-43576194 GCTGTCAGACCTCAGTCTGGCGG 0: 1
1: 0
2: 3
3: 18
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007673528 Original CRISPR GCTGTCAGACCTCAGTCTGG CGG Exonic
903153460 1:21429060-21429082 GCTGGCCGACCTGAGCCTGGTGG + Intergenic
906736078 1:48129764-48129786 ACTGACAGACCTCAGACTCGTGG + Intergenic
908635043 1:66154226-66154248 CCTTTAAGAGCTCAGTCTGGTGG - Intronic
910098752 1:83554331-83554353 GGTGCCAGACCTTGGTCTGGGGG + Intergenic
911205128 1:95084906-95084928 TCTTCCAGACCTCAGTCTGGTGG + Intergenic
915570956 1:156744787-156744809 ACTGTGAGACAGCAGTCTGGGGG - Intronic
917020978 1:170586586-170586608 GCTTGCAGACCTCAGCCTGGAGG + Intergenic
918315871 1:183322344-183322366 GCTGTCAGACCTGGGTATGGGGG + Intronic
920504803 1:206508087-206508109 GCGGGGAGACCGCAGTCTGGGGG + Intronic
920968885 1:210725516-210725538 GCTCTCTCAACTCAGTCTGGGGG + Intronic
921218705 1:212958209-212958231 GCTGTCTGGGCTCAGCCTGGAGG - Intronic
922116261 1:222617746-222617768 GCTGTCAGTCCTCCTCCTGGAGG + Intergenic
924384862 1:243491037-243491059 TCTGTCAGACCTCAGGTTGTGGG + Intronic
1066267165 10:33787621-33787643 ACTGGCACACCTCAGCCTGGAGG + Intergenic
1067409583 10:46052842-46052864 GCTGCCAGAAGTCAGTCTGGGGG + Intergenic
1067475871 10:46565692-46565714 GCTGGCAGAGCACAGTCAGGAGG - Intergenic
1067618866 10:47776083-47776105 GCTGGCAGAGCACAGTCAGGAGG + Intergenic
1067899267 10:50221354-50221376 GCTGGCTGACCTCAGTGTGATGG - Intronic
1070400261 10:76047048-76047070 CCTGTGAGACCTCAGGGTGGGGG - Intronic
1070850275 10:79557571-79557593 GCTCTCAGCCCTCAGTCTGCAGG - Exonic
1070854509 10:79595643-79595665 GCTCTCAGCCCTCAGTCTTCAGG - Intergenic
1070856950 10:79613729-79613751 GCTCTCAGCCCTCAGTCTGCAGG + Exonic
1072427381 10:95341190-95341212 GCTATCACACCCCAGTCTGGGGG - Intronic
1072569364 10:96645170-96645192 GCTCTCAGCCCTCAGTCTCCAGG - Intronic
1075715442 10:124552610-124552632 GCTGGCAGGCCCCAGCCTGGGGG - Intronic
1076842455 10:133052485-133052507 GCCCTCAGCCCTCAGGCTGGAGG + Intergenic
1077808481 11:5613296-5613318 GCCGTTAGTCCTCAGTCTGTTGG + Intronic
1077868401 11:6241314-6241336 CCTGTTAGATCTCAGTATGGTGG + Intronic
1077981619 11:7306842-7306864 GCTCACAGAACTCAGTCTAGAGG - Intronic
1084633427 11:70372779-70372801 GTTCTCACACATCAGTCTGGAGG + Intronic
1084659676 11:70539443-70539465 GCTGTGACACCGCGGTCTGGGGG + Intronic
1084773021 11:71356701-71356723 GCTGCCTGGCCTCAGCCTGGAGG - Intergenic
1088035002 11:105300623-105300645 GCTGACAGACCTCAGCCTACTGG + Intergenic
1088771618 11:113041748-113041770 CCAGTCAGACCTCACCCTGGAGG - Intronic
1089364003 11:117909953-117909975 GCCCTCAGTCCGCAGTCTGGAGG + Exonic
1090663128 11:128895706-128895728 GCTCTCAGACCACTGCCTGGGGG + Intronic
1091389550 12:117701-117723 GCTGTGAGACCAAAGCCTGGAGG + Intronic
1097804430 12:63950048-63950070 GTTATCAGACCTCAGGCTGCCGG + Intronic
1098890281 12:76003597-76003619 GAGGTCAGAAATCAGTCTGGGGG + Intergenic
1100270566 12:93020689-93020711 GCTGAGAGACCTCAGGCTGATGG + Intergenic
1106100335 13:26689850-26689872 CCTCCCAGAGCTCAGTCTGGTGG - Intergenic
1106146512 13:27054186-27054208 GCAGTCACATCTCAGTGTGGAGG + Intergenic
1106907030 13:34420068-34420090 GCAGTCACACCTCAGGCTGCAGG - Intergenic
1108492035 13:50991583-50991605 TCTGTCAGTCCTCAGCCTGCAGG + Intergenic
1112157391 13:96832721-96832743 GCTGGCTGACCTCAGCCTGGTGG + Exonic
1113409112 13:110068604-110068626 GCTGCCAGACCACAGGGTGGTGG - Intergenic
1114418550 14:22560205-22560227 GCTGTCAGATCTCAGCCTAAAGG + Intergenic
1114438595 14:22728379-22728401 GCTGTCAGACCATAATCTGATGG - Intergenic
1117495202 14:56295483-56295505 GATGTCAGGCCTCAGTAGGGAGG - Intronic
1118632888 14:67722435-67722457 GCTGTCAGAGCACAGCCTGCTGG - Exonic
1119541351 14:75440222-75440244 GCTGTCAGACTGCAGTGTTGTGG + Intronic
1125318238 15:38454908-38454930 GCTGTGAGAACTCAGGGTGGAGG + Intronic
1129771573 15:78206402-78206424 CCTGTCTGCCCTCAGACTGGGGG + Intronic
1131068542 15:89449435-89449457 GCAGTCAGACCTCAGTCGGTGGG + Intergenic
1132072259 15:98788670-98788692 GCTGTCAGACCTCAGCAGGGCGG - Intronic
1133218435 16:4307570-4307592 GCTGTCGGCGCCCAGTCTGGCGG + Intergenic
1140480240 16:75258447-75258469 ACAGTTAGACCTCAGTCAGGAGG - Intronic
1141690809 16:85595213-85595235 GCTTCCAGAACGCAGTCTGGAGG - Intergenic
1143870750 17:9956032-9956054 GCTCTCACACCTCAGCCAGGTGG - Intronic
1144182495 17:12765482-12765504 GCTGCCAGATCTTATTCTGGGGG + Exonic
1144202816 17:12956524-12956546 GCTCTCAAACCTCTGTCTGTGGG + Intronic
1145814243 17:27783927-27783949 GCTATCGGAGCTCAGTCTGCAGG + Intronic
1146770926 17:35568102-35568124 GCTGTAAGACCTGAGCCGGGCGG + Intergenic
1146997063 17:37330404-37330426 GCTGTAAGAGCTCATTTTGGAGG - Exonic
1152239561 17:79154341-79154363 GCTGTTAGCCCTCTGTCTCGGGG + Intronic
1157021917 18:43793288-43793310 GCTGTCAGGGGTCAGTCTGCGGG - Intergenic
1157541652 18:48515146-48515168 GCTGTCAGAGCTGGGTCTGATGG + Intergenic
1161007303 19:1942989-1943011 GCTCTCAGAGCTCACTGTGGGGG - Intronic
1163595728 19:18220137-18220159 TATGATAGACCTCAGTCTGGGGG - Intronic
926216513 2:10908968-10908990 GCTGGCAGGCCTGAGGCTGGTGG - Intergenic
938063369 2:128268617-128268639 GCTGGCCGACCTGAGCCTGGTGG - Exonic
940916624 2:159263613-159263635 CCTGTCAGGTCTCAGTCTGAGGG - Intronic
942783460 2:179672904-179672926 GCTGTCAGACCTAAGTCTCTAGG - Intronic
945963161 2:216157061-216157083 GCTGTCTGTCCTCAGTCTGGTGG - Intronic
1170155455 20:13265006-13265028 GCTGTCAGACCAAAGGCTGGTGG + Intronic
1172228794 20:33323256-33323278 GCTGGCAGACTGCAGTCAGGAGG - Intergenic
1174850539 20:53989676-53989698 GCTGGCAGAACTCCATCTGGGGG - Intronic
1175280526 20:57801205-57801227 GTTGTCACAGCTCAGCCTGGGGG + Intergenic
1178499704 21:33115730-33115752 GCTGTCTTCCCACAGTCTGGAGG + Intergenic
1182518318 22:30871414-30871436 GCAGTCAGACCTGTGTCTGGAGG - Intronic
1182924412 22:34109008-34109030 GCTGGCAGAACTCAGTGTCGTGG + Intergenic
1184204870 22:42995701-42995723 GCTTTAAGGCCTCTGTCTGGTGG - Intronic
1184452716 22:44592503-44592525 GGTGTCAAACCTCAGGGTGGTGG - Intergenic
1184786598 22:46674951-46674973 GCTGCCATCCCTCAGGCTGGCGG + Intronic
1184801198 22:46761251-46761273 GCTGTCAGGGCTCTGTCAGGAGG + Intergenic
1184820000 22:46903172-46903194 GGTCACAGACCTCAGCCTGGTGG + Intronic
951721074 3:25698970-25698992 CCTGTCATACCTCAGTCTTTGGG + Intergenic
951919522 3:27839030-27839052 GCTGTGAGGCATCAGTCTGTAGG + Intergenic
954032118 3:47827005-47827027 TCTTTCAGACATCAGACTGGGGG + Intronic
955740871 3:62090506-62090528 GCTGTCAGACCAAAGTTTTGTGG + Intronic
965778714 3:172260850-172260872 CCTGTCAGACCCCATTCTGTGGG - Intronic
968000605 3:195203478-195203500 GCTGTCAGTCCCAAGCCTGGGGG - Intronic
969209070 4:5672430-5672452 GCTGTATGACTTCAGCCTGGAGG + Intronic
973155981 4:46953239-46953261 GCTGGCAGAACTCAGATTGGTGG - Intronic
974026712 4:56739198-56739220 TTTGTCAGACCTCAGACAGGAGG - Intergenic
975621524 4:76301647-76301669 GCTGTCAGACCTCTGGCTCCTGG - Intronic
975844733 4:78513171-78513193 ACTATCAGTCCTCTGTCTGGAGG + Intronic
977105982 4:92885293-92885315 GCTGACAGAGCTAAGCCTGGGGG + Intronic
978634087 4:110783089-110783111 GGTGTCAGAGCTGAGACTGGAGG + Intergenic
984704792 4:182839834-182839856 GCTGTCAGCACTCAGTCAGTGGG - Intergenic
985513112 5:322989-323011 GCTGTCAGCTCACAGCCTGGTGG + Intronic
986408078 5:7447285-7447307 GCAGTTAGACCTCAGTGTGCAGG - Intronic
988631332 5:32934518-32934540 GCTTTCAGACCAGAGCCTGGGGG - Intergenic
988806200 5:34743055-34743077 GCTGTCAGACTGCAGTCAGTAGG + Intronic
990849100 5:60181382-60181404 GCTGTCAGTTTTGAGTCTGGGGG - Intronic
997791992 5:136769812-136769834 GCTTTCAGAGCACAGTGTGGTGG + Intergenic
997793066 5:136779945-136779967 GCTGTCAGCCATCACCCTGGTGG - Intergenic
1001666292 5:173436115-173436137 GCTGTGAGACCCAAGTCTCGTGG + Intergenic
1001879317 5:175229553-175229575 GCAGTCAGCCCTCAGCCTAGAGG + Intergenic
1002339591 5:178506212-178506234 GCAGTCAGGTCTCAGCCTGGAGG + Intronic
1004635786 6:17466319-17466341 GTTGTCAGAACTCAGACTGCTGG + Intronic
1005749142 6:28866991-28867013 GCTGTCACCTCTCAGTATGGCGG + Intergenic
1007324536 6:41049879-41049901 GCTGTCAGTCATCAGTCTGGGGG + Intronic
1007386391 6:41523059-41523081 GCTGTCAAATCTCAGCCAGGAGG + Intergenic
1007446393 6:41909595-41909617 GCTGTCTGGCCTCATTCCGGGGG - Intronic
1007673528 6:43576172-43576194 GCTGTCAGACCTCAGTCTGGCGG + Exonic
1008637013 6:53420585-53420607 CCTGTCATACCTCAGTCTTTGGG - Intergenic
1008844704 6:55949537-55949559 GGTGTCAGACCTCTTTCTGAAGG - Intergenic
1009861357 6:69337674-69337696 GCTTTCAGACATGAGTGTGGGGG - Intronic
1010199398 6:73269423-73269445 GCTGTCACCTCTCAGTCAGGCGG + Intronic
1019349962 7:550013-550035 ACACTCAGACCTCAATCTGGGGG + Exonic
1019552642 7:1610743-1610765 GCTGGCAGACCGCAGCCTGGGGG + Intergenic
1023229688 7:38013486-38013508 GGTGTCAGAGGGCAGTCTGGTGG - Intronic
1029400616 7:100343152-100343174 GTTGACAGCACTCAGTCTGGAGG + Intronic
1032891524 7:136199924-136199946 GCTGTCAGGATGCAGTCTGGTGG + Intergenic
1036775308 8:11607790-11607812 GCTGTAAGACCGTAATCTGGGGG + Intergenic
1040101667 8:43511805-43511827 GCTGTGTGACCTCAGGCAGGGGG + Intergenic
1041113199 8:54507009-54507031 TCTGTCAGGCCTCAGGCTTGGGG - Intergenic
1041932691 8:63304516-63304538 GCTCTCAGACATAATTCTGGGGG + Intergenic
1048014418 8:130484698-130484720 GTTGTTAGAACTCAGTCTGTGGG - Intergenic
1049245156 8:141558499-141558521 GCTGTGCGACCTCAGGCAGGTGG - Intergenic
1049427613 8:142544399-142544421 CCGCTCAGACCTCGGTCTGGAGG - Exonic
1049854130 8:144851015-144851037 GGTGTCAGGCTTCAGGCTGGTGG + Exonic
1049952187 9:656080-656102 GCTGTCAGACCGCAGGCTCTGGG + Intronic
1050842807 9:10173732-10173754 GCTGTCAGTCCTCATTCTTGAGG + Intronic
1051668102 9:19484276-19484298 TCTGTCAGGCCTCACTCTGGTGG + Intergenic
1053269361 9:36739701-36739723 GCTGTCAGGCCTCCGTCCCGGGG - Intergenic
1056288440 9:85115026-85115048 GCTGTCAGTCCTCACAGTGGTGG - Intergenic
1059212988 9:112531975-112531997 GCTGTCAGACCTCAATTTGAGGG + Intronic
1062483294 9:136762361-136762383 GCTGTCAGCCCTCAGGCTGGTGG - Intronic
1192218834 X:69182996-69183018 GTTGTCAGAACTCAGGGTGGGGG - Intergenic
1193036483 X:76957255-76957277 GCTGTGTGACCTCACTCTAGGGG + Intergenic
1194432299 X:93824017-93824039 GCTGTCAGAACTCACACTGGTGG + Intergenic
1196048916 X:111284353-111284375 GCTGGCAGGTCTCAATCTGGGGG + Intergenic
1196854783 X:119972643-119972665 GAGGTCAGAACTCAGTCTGATGG + Intergenic
1200910394 Y:8526802-8526824 GCTCTCACACCTCAAACTGGGGG - Intergenic