ID: 1007673530

View in Genome Browser
Species Human (GRCh38)
Location 6:43576184-43576206
Sequence CAGTCTGGCGGCTGCATTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007673525_1007673530 6 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673530 6:43576184-43576206 CAGTCTGGCGGCTGCATTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 193
1007673526_1007673530 5 Left 1007673526 6:43576156-43576178 CCTTCGCAGCGGGCGCGCTGTCA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1007673530 6:43576184-43576206 CAGTCTGGCGGCTGCATTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 193
1007673522_1007673530 18 Left 1007673522 6:43576143-43576165 CCGCGTCAACGGCCCTTCGCAGC 0: 1
1: 0
2: 0
3: 1
4: 90
Right 1007673530 6:43576184-43576206 CAGTCTGGCGGCTGCATTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007673530 Original CRISPR CAGTCTGGCGGCTGCATTGC TGG Exonic
900559725 1:3297958-3297980 CAGTCTGGCCCCTGCAGAGCTGG - Intronic
900724912 1:4209805-4209827 CAGACTGAAGGCTGCACTGCTGG - Intergenic
900819908 1:4878718-4878740 CAGACTGAAGGCTGCACTGCTGG + Intergenic
902568316 1:17330505-17330527 CAGACTGAAGGCTGCATTGTTGG - Intronic
903369628 1:22826845-22826867 CAGACTGGCTCCAGCATTGCTGG - Intronic
903542083 1:24102208-24102230 CAGGCTGGGGGCTGCATGGTGGG - Intronic
904901243 1:33858783-33858805 CAGTGTGGCTGCTGCTTTGATGG - Intronic
905314861 1:37075837-37075859 AAGTCTGCTGGCAGCATTGCTGG + Intergenic
906116694 1:43361690-43361712 CAGCATGGAGGATGCATTGCAGG - Intronic
906872714 1:49502204-49502226 CAGACTGGAGGCTGCACTGTTGG + Intronic
911700779 1:100949735-100949757 CAGCCAGGCTGCAGCATTGCAGG + Intronic
913131164 1:115839194-115839216 CAGTCTGGCGACCACCTTGCGGG + Exonic
915720172 1:157978899-157978921 CAGTCTGGGGGCTGCAGGCCAGG + Intergenic
919981996 1:202647531-202647553 CAGTGTGGAGGCAGCCTTGCTGG + Intronic
922388086 1:225108272-225108294 CAGACTGAAGGCTGCATTGTTGG + Intronic
923391946 1:233520968-233520990 CAGACTGGGGCCTGCACTGCTGG + Intergenic
923799969 1:237199333-237199355 CAGACTGAAGGCTGCACTGCTGG - Intronic
1062803557 10:397678-397700 AAGTGGGGCGGCTGCAGTGCAGG - Intronic
1065281701 10:24145685-24145707 CAGACTGAAGGCTGCATTGTTGG - Intronic
1066277977 10:33887471-33887493 CAGTTTGGTGGCTGAATTTCAGG + Intergenic
1066654393 10:37685000-37685022 GAGGCTGGCGGCAGCATTGGCGG + Intergenic
1067527941 10:47049611-47049633 CAGCCTGGAGGCTGTACTGCAGG + Intergenic
1067743097 10:48911707-48911729 CAGTATGTCAGCTGCAATGCTGG - Intronic
1067812559 10:49441368-49441390 CAGTGTGGAAGCTGCACTGCGGG - Intergenic
1068942627 10:62694453-62694475 CAGTATGGCTGCTGCAGTTCTGG - Intergenic
1071528991 10:86374883-86374905 CTGTCTGCTGGCTGCCTTGCTGG - Intergenic
1071595840 10:86923634-86923656 GAGTCTGGAGGCTGGATTGTGGG - Exonic
1073053986 10:100687390-100687412 AACTCTGGCGGCTGCCCTGCCGG + Intergenic
1076688578 10:132209240-132209262 CAGTCTGGCTGCTGGAGGGCCGG - Intronic
1077314274 11:1910184-1910206 CAGTCCGGCATTTGCATTGCTGG - Intergenic
1077414405 11:2418074-2418096 TGGGCTGGAGGCTGCATTGCAGG + Intronic
1078178246 11:8987121-8987143 CTTTCTGGAGGATGCATTGCAGG - Intronic
1084478641 11:69403652-69403674 CAGGCTGGTGGCTCCCTTGCAGG + Intergenic
1086080723 11:82900407-82900429 CAGGCTGGAGACTGCAGTGCGGG + Exonic
1086181376 11:83955881-83955903 CAGACTGAAGGCTGCACTGCTGG + Intronic
1086768813 11:90734251-90734273 CAGTCTGGCTGCTACATGGCTGG + Intergenic
1087116297 11:94528645-94528667 CAGTCTGGTGGCCTCATTCCTGG - Intergenic
1089302211 11:117505482-117505504 CACGGTGGCGGCTGCGTTGCTGG + Exonic
1089834902 11:121361913-121361935 GAGTCTGGAGGCTGGATTGTGGG + Intergenic
1089840500 11:121413416-121413438 CAGACTGAAGGCTGCATTGTTGG - Intergenic
1090388537 11:126371787-126371809 CAATCTGGCGATTGCATTTCCGG - Intronic
1092165870 12:6341858-6341880 CAGTGTGGCAGCGGCAGTGCTGG + Exonic
1093366787 12:18311896-18311918 CAGACTGAAGGCTGCATTGTCGG - Intronic
1093410948 12:18865885-18865907 CAGCCTGGCGGCTGAATTTTTGG + Intergenic
1096611973 12:52808030-52808052 CAGTCTGGTGGAGGCATTGGTGG - Intronic
1097058643 12:56266449-56266471 CAGACTGAAGGCTGCACTGCCGG + Intergenic
1097102860 12:56601609-56601631 CGGTGTGGGGGCAGCATTGCAGG + Exonic
1098361776 12:69661442-69661464 CAGTCAGGCGACTGCCTTGGAGG + Intronic
1098832341 12:75377469-75377491 CAGACTGATGGCTGCATTGTGGG - Intronic
1104597416 12:130129331-130129353 CAATATGGCGGCTGGATTCCAGG + Intergenic
1105602792 13:21902044-21902066 CAATCTGCTGGCTGCTTTGCTGG + Intergenic
1107400650 13:40065913-40065935 CAGTCTGAAGGCTACATTGTTGG - Intergenic
1109308389 13:60664206-60664228 CAGGGTGGGGGCTGCATTGCAGG - Intergenic
1110174735 13:72542396-72542418 TAGTCTGGCAGCAGCATTGAGGG - Intergenic
1112109873 13:96284360-96284382 CAGACTGAAGGCTGCATTGTCGG - Intronic
1112238207 13:97655440-97655462 CAGACTGGAGGCTGCACTGTTGG - Intergenic
1118983476 14:70733976-70733998 CAGACTGGGAGCTGCACTGCTGG + Intronic
1124454373 15:29827123-29827145 CTGTCTGGTGGCTGCCTGGCTGG + Intronic
1125921253 15:43527125-43527147 CAGTGTGGTGGCTGCAGTGCAGG + Exonic
1127139511 15:55960517-55960539 CAGACTGAAGGCTGCATTGTTGG + Intronic
1129521150 15:76187012-76187034 CGGGCTGTCAGCTGCATTGCAGG - Intronic
1130414062 15:83673457-83673479 CAGTCTGTTGGCATCATTGCTGG + Intronic
1135054908 16:19223410-19223432 CAGGATGGCGTCTACATTGCAGG - Intronic
1135959524 16:26984227-26984249 CAGACTGGAGGCTGCACTGTGGG - Intergenic
1136182636 16:28564960-28564982 CAGACTGACAGCTGCACTGCTGG - Intronic
1137816385 16:51401800-51401822 CAGACTGAAGGCTGCATTGCTGG - Intergenic
1141955888 16:87371016-87371038 CAGGCTGGTGGCTGCAGAGCTGG - Intronic
1141971310 16:87485062-87485084 CAGTGGGGCGGGTGCTTTGCAGG - Intronic
1143140548 17:4739753-4739775 CTGTGAGGCGGCTGCACTGCCGG + Exonic
1143353513 17:6307221-6307243 CAGACTGGGGGCTGCACTGTGGG + Intergenic
1144803132 17:17944985-17945007 TAGTGTGGCGGCGGCAGTGCGGG - Intronic
1146723922 17:35142257-35142279 CAGGATGGCGGCAGCAGTGCCGG - Exonic
1147506891 17:41027029-41027051 TAGTCTGGCAGCTGCGTGGCTGG + Exonic
1148090690 17:45020978-45021000 AAGTCGGGCGGCCGGATTGCTGG - Intergenic
1148801335 17:50228324-50228346 CAGACTGAAGGCTGCATTGTCGG + Intergenic
1149397676 17:56261573-56261595 CAGACTGGAGGCTGCACTGTTGG - Intronic
1151310581 17:73290297-73290319 AGCTCTGGCGGCGGCATTGCTGG + Intronic
1151530878 17:74703947-74703969 CAGTCAAACGGCTGCATTCCTGG - Intronic
1152095476 17:78269463-78269485 CAGCCTGGGGCCCGCATTGCCGG - Intergenic
1153424360 18:4945757-4945779 GAGTGAGGCAGCTGCATTGCTGG - Intergenic
1156354492 18:36329571-36329593 CAGTCTGGGGGCTGCAGTGATGG + Intronic
1157520727 18:48343520-48343542 CACTCTGGAGGCCGCATTGCTGG + Intronic
1157566289 18:48681087-48681109 CTGCCTGGCCGCTGCAATGCTGG - Intronic
1158365779 18:56734044-56734066 CAGCCTTGAGGCTGCAATGCAGG - Intronic
1158587916 18:58757093-58757115 CAGTCTGGCTGGTGCAATCCGGG - Intergenic
1158790532 18:60774986-60775008 CAGTCAGTTGGCTTCATTGCTGG - Intergenic
1158946111 18:62448273-62448295 CAGACTGGAGGCTGCACTGTCGG + Intergenic
1160212658 18:76895458-76895480 CGGTGTGGGTGCTGCATTGCGGG - Intronic
1165145543 19:33727784-33727806 CGGGCTGGTGGCTGCATTCCAGG + Intronic
1165527784 19:36370612-36370634 CACTCTGGCTGGTGCAGTGCTGG - Intronic
1167622090 19:50566277-50566299 CTGTCTGGCGGCTGCGCGGCCGG + Intronic
1167719923 19:51172271-51172293 CAGGCTGGAGGCTGAATTGGTGG + Intergenic
1168275624 19:55276749-55276771 GAGGGTGGCGGCTGCACTGCAGG + Intronic
925245934 2:2382905-2382927 CAGACTGAAGGCTGCACTGCTGG + Intergenic
925317106 2:2934852-2934874 GAGTCAGGTGGCTGCAGTGCTGG - Intergenic
925540025 2:4956843-4956865 CAGACTGGAGGCTGCACTGTTGG - Intergenic
925592145 2:5520482-5520504 CAGTCAGGCTGCAGCATGGCGGG - Intergenic
926942651 2:18154551-18154573 CAGACTGAAGGCTGCACTGCCGG - Intronic
930951332 2:57146836-57146858 CAGTCTGGAGTCTGCATGGGAGG + Intergenic
934580137 2:95431085-95431107 CAGTGTGGCGAATGGATTGCAGG - Intergenic
934599310 2:95645640-95645662 CAGTGTGGCGAATGGATTGCAGG + Intergenic
936339257 2:111616897-111616919 CACTCTGTCGGCTGAAGTGCGGG - Intergenic
938323635 2:130382501-130382523 GAGCATGGCGGCTGCCTTGCTGG + Intergenic
938509074 2:131921164-131921186 CAGACTGAAGGCTGCACTGCCGG - Intergenic
938749840 2:134317982-134318004 CAGTCTGGAGGCTTCAGAGCAGG - Intronic
941036358 2:160573101-160573123 CAGGCTGAAGGCTGCACTGCTGG + Intergenic
942140957 2:172977248-172977270 CAGTCTGGGGGCTGATTTACAGG + Intronic
943233611 2:185290239-185290261 CAGCCAGGCTGCAGCATTGCAGG - Intergenic
945963159 2:216157049-216157071 CAGTCTGGTGGCTTTGTTGCTGG - Intronic
947136205 2:226979129-226979151 CAGACTGACGGCTGCGCTGCAGG - Intronic
947854405 2:233313477-233313499 CAATTTGGAGGCTGCCTTGCAGG - Intronic
1169024169 20:2353438-2353460 CCGTCTGGTGGCTGCGTTACTGG - Intergenic
1173192377 20:40886425-40886447 CAGGCTGGCTCCTCCATTGCTGG + Intergenic
1173924316 20:46769418-46769440 CAGACTGGGAGCTGCACTGCAGG + Intergenic
1174411500 20:50339582-50339604 GAGTCAGGAGGCTGGATTGCTGG - Intergenic
1174853497 20:54019852-54019874 CAGACTGACGGCTGCACTGTCGG + Intronic
1176784412 21:13237375-13237397 CAGACTGAAGGCTGCACTGCCGG + Intergenic
1177489653 21:21805708-21805730 CAGACTGAAGGCTGCATTGCTGG + Intergenic
1179606894 21:42522454-42522476 CACTCGGGCCGCTGCCTTGCTGG - Intronic
1180019741 21:45114864-45114886 GAGCCAGGGGGCTGCATTGCTGG + Intronic
1180797107 22:18611356-18611378 CAGCCCGGCGGCGGCAGTGCTGG - Exonic
1181224616 22:21383915-21383937 CAGCCCGGCGGCGGCAGTGCTGG + Exonic
1181254016 22:21550898-21550920 CAGCCCGGCGGCGGCAGTGCTGG - Exonic
1181568793 22:23755520-23755542 CCGTCTGGCAGCTCCATTCCTGG - Intergenic
950906864 3:16546385-16546407 CAGGCGGGCGGCTGCACTGCTGG - Intergenic
951053819 3:18124485-18124507 CAGTGTGGAGGATGCATTGGAGG + Intronic
955192842 3:56777821-56777843 GACTCAGGCTGCTGCATTGCAGG + Intronic
958011094 3:87881351-87881373 CAGCCAGGCTGCTGCCTTGCAGG - Intergenic
962268194 3:133958397-133958419 CTGTCTGGCTGCTGCACTGGGGG - Intronic
968982959 4:3860626-3860648 AGGTCTGGGGGCAGCATTGCAGG - Intergenic
969139399 4:5055468-5055490 CACTCTGGATGCTGCATTGAGGG - Intronic
969251734 4:5972789-5972811 TAGTCTGGCGGGGGCGTTGCTGG + Intronic
969829302 4:9782024-9782046 CTGCCTGGCGGCAGCATTTCGGG - Exonic
970052315 4:11928584-11928606 CAGACTGACGGCTGCACTGCTGG + Intergenic
970415680 4:15854649-15854671 CAGACTGAAGGCTGCACTGCTGG - Intergenic
970706320 4:18807680-18807702 CAGACTGAAGGTTGCATTGCTGG - Intergenic
974203080 4:58666154-58666176 CAGACTGAAGGCTGCACTGCTGG - Intergenic
974560082 4:63506212-63506234 CAGTCTGGAGACTGCTGTGCTGG - Intergenic
975441370 4:74414445-74414467 CATTCTGGAGGCAACATTGCTGG - Intergenic
977846845 4:101777018-101777040 CAGACTGAAGGCTGCATTGTTGG + Intronic
980694289 4:136336404-136336426 CAGTCTGGAGACCCCATTGCAGG - Intergenic
983785144 4:171720739-171720761 CAGACTGCAGGCTGCACTGCTGG + Intergenic
988252852 5:28782567-28782589 CAGACTGAAGGCTGCATTGTCGG + Intergenic
989571580 5:42951055-42951077 CAGTCCGGTGGCTGCGCTGCTGG - Intergenic
991218194 5:64180959-64180981 CAGACTGAAGGCTGCATTGTTGG - Intronic
993180157 5:84542257-84542279 CAGTATGGCAGCTGAATTCCAGG + Intergenic
993246661 5:85460103-85460125 CAGTCTGGAGGCTCCACGGCTGG + Intergenic
994039401 5:95241298-95241320 CAGTATGGCAGCTGCTTTGCAGG + Intronic
995291606 5:110462593-110462615 CAGACTGAAGGCTGCACTGCTGG + Intronic
997401038 5:133602640-133602662 GAGTCTGGAGGCTGGCTTGCTGG - Intronic
999086100 5:148891595-148891617 TAGTCTGCCAGCTGGATTGCAGG + Intergenic
999994886 5:157082982-157083004 CAGGCTGGCGACAGCCTTGCTGG + Intergenic
1001980652 5:176035323-176035345 CAATCCGGGGGCTGCATTGCCGG - Intergenic
1002236809 5:177808742-177808764 CAATCCGGGGGCTGCATTGCCGG + Intergenic
1002434405 5:179222026-179222048 CAGAGTGGCGGCTGCACTGGGGG - Intronic
1002588723 5:180272134-180272156 CAGGATGGTGGCTGCATGGCAGG - Intronic
1003065941 6:2903485-2903507 CAGGCTGGCGGGAGCATTGGCGG - Intergenic
1003086243 6:3063743-3063765 CAGGCTGGCGGGAGCATTGGCGG + Intergenic
1007673530 6:43576184-43576206 CAGTCTGGCGGCTGCATTGCTGG + Exonic
1008011076 6:46468499-46468521 CAGGATGGGGGCTGCTTTGCTGG - Intronic
1008319038 6:50084007-50084029 CAGTCTGGCCACTCCATTACCGG - Intergenic
1009371498 6:62908886-62908908 CAGACTGAAGACTGCATTGCTGG + Intergenic
1013392716 6:109702926-109702948 CAGAATGGCGGCTGTAGTGCAGG - Intronic
1015075913 6:129157586-129157608 GAGTCTGGGGGCTGGATTGTGGG + Intronic
1016324809 6:142888581-142888603 CACTCTTGCAGGTGCATTGCAGG - Intronic
1018190738 6:161307297-161307319 CAGACTGAAGGCTGCATTGTTGG - Intergenic
1024005431 7:45222051-45222073 CATCCTGGCTGCTGCACTGCGGG + Intergenic
1027686151 7:81280680-81280702 CAGACTGGAGGCTGCACTGTTGG + Intergenic
1032527490 7:132590494-132590516 CAGACTGGAGGCTGCACTGTCGG - Intronic
1032603693 7:133326923-133326945 CAGCCTTGCTGCTGCCTTGCAGG + Intronic
1033861206 7:145630353-145630375 CAGACTGATGGCTGCATTGTCGG + Intergenic
1034807788 7:154103889-154103911 CAGTCTGAAGGCTGCATTGTCGG + Intronic
1035670108 8:1410365-1410387 CAGACTGGCGTCTGCTCTGCTGG - Intergenic
1035673244 8:1436218-1436240 CAGACTGAAGGCTGCACTGCCGG - Intergenic
1037932784 8:22892426-22892448 CAGTTTGGTGGCTTCATTCCTGG + Intronic
1038127195 8:24687767-24687789 CAGACTGAAGGCTGCACTGCTGG + Intergenic
1038418088 8:27412297-27412319 CAGGATGGGGGCTGCAATGCTGG - Intronic
1041210808 8:55549205-55549227 CAGACTGAAGGCTGCATTGTTGG + Intergenic
1043335989 8:79177720-79177742 CAGTCTGGAGGCTGGATTCTTGG - Intergenic
1044458514 8:92416842-92416864 CAGTCTGAAGGCTGCACTGTTGG + Intergenic
1046550110 8:115705373-115705395 CAGTTTGGAGGCTGCATTGGAGG - Intronic
1048217294 8:132508083-132508105 CAGACTGAAGGCTGCACTGCTGG - Intergenic
1049545681 8:143229518-143229540 CGGTCTGGAGGCTGCCATGCTGG - Intergenic
1051299678 9:15635235-15635257 CAGACTGAAGGCTGCACTGCTGG - Intronic
1051538240 9:18184334-18184356 CAGACTGGTGGCTGCAGTGAAGG + Intergenic
1051719120 9:20017640-20017662 CAGACTGAAGGCTGCATTGTTGG - Intergenic
1055724409 9:79212088-79212110 CAGACTGGAGGCTGCACTGTTGG + Intergenic
1055940287 9:81643048-81643070 TAGAATGGCGGCTGCCTTGCGGG + Intronic
1058765611 9:108180138-108180160 CAGACTGGACGCTGCACTGCTGG + Intergenic
1059494505 9:114698535-114698557 CAGCCTGGAGGCTGCTTTTCTGG + Intergenic
1059636597 9:116177586-116177608 CAGTCTTGGGGCTGCCATGCAGG + Intronic
1061087948 9:128410091-128410113 CAGTCTGGAGGCAGCAGAGCTGG + Intergenic
1062082487 9:134631591-134631613 CAGACTGAAGGCTGCATTGTGGG + Intergenic
1062179264 9:135182060-135182082 CAGACTGAAGGCTGCACTGCCGG + Intergenic
1185513843 X:683590-683612 CAGTGTGGAGACTGGATTGCAGG + Intergenic
1187319514 X:18227212-18227234 CAGACTGAAGGCTGCACTGCTGG - Intergenic
1188387160 X:29575376-29575398 CAGACTGAAGGCTGCACTGCTGG - Intronic
1190524701 X:51317072-51317094 CAGACTGAAGGCTGCATTGTCGG + Intergenic
1192827998 X:74718608-74718630 CAGACTGAAGGCTGCATTGTTGG + Intergenic
1192857279 X:75025531-75025553 CTGCCAGGCTGCTGCATTGCAGG + Intergenic
1194278975 X:91923559-91923581 CAGACTGAAGGCTGCATTGTCGG + Intronic
1194933505 X:99918188-99918210 CAGACTGGGGTCTGCATTGTCGG + Intergenic
1196230679 X:113217529-113217551 CAGACTGAAGGCTGCATTGTCGG - Intergenic
1196512254 X:116525523-116525545 CAGACTGAAGGCTGCATTGTTGG - Intergenic
1198463562 X:136884984-136885006 CAGTCTGGAGACTGTATTGGGGG + Intergenic
1198615331 X:138452326-138452348 CAGACTGAAGGCTGCATTGTCGG + Intergenic
1198843887 X:140888726-140888748 CAGCTTGCCTGCTGCATTGCTGG + Intergenic
1200596452 Y:5147060-5147082 CAGACTGAAGGCTGCATTGTCGG + Intronic