ID: 1007673531

View in Genome Browser
Species Human (GRCh38)
Location 6:43576185-43576207
Sequence AGTCTGGCGGCTGCATTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007673526_1007673531 6 Left 1007673526 6:43576156-43576178 CCTTCGCAGCGGGCGCGCTGTCA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1007673531 6:43576185-43576207 AGTCTGGCGGCTGCATTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 110
1007673522_1007673531 19 Left 1007673522 6:43576143-43576165 CCGCGTCAACGGCCCTTCGCAGC 0: 1
1: 0
2: 0
3: 1
4: 90
Right 1007673531 6:43576185-43576207 AGTCTGGCGGCTGCATTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 110
1007673525_1007673531 7 Left 1007673525 6:43576155-43576177 CCCTTCGCAGCGGGCGCGCTGTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1007673531 6:43576185-43576207 AGTCTGGCGGCTGCATTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007673531 Original CRISPR AGTCTGGCGGCTGCATTGCT GGG Exonic
900187344 1:1338582-1338604 AGTCTGGCAGCTGCATGACCCGG + Exonic
901762380 1:11479414-11479436 GGGCTGGGGGATGCATTGCTAGG + Intronic
907337310 1:53708584-53708606 AGCCTGGCTGCTGACTTGCTAGG - Intronic
912962243 1:114206701-114206723 AGTCTGACTTCTGCCTTGCTGGG - Intergenic
919881905 1:201906470-201906492 AGACTGGCAGCTGCAGTGCCTGG - Intronic
1064161881 10:12953618-12953640 AGTCTTACTGCTGCCTTGCTGGG + Intronic
1067089507 10:43259424-43259446 AGTCAGGCCCCTGCACTGCTCGG - Intronic
1068942626 10:62694452-62694474 AGTATGGCTGCTGCAGTTCTGGG - Intergenic
1072275987 10:93824067-93824089 ATCCTTGCTGCTGCATTGCTGGG - Intergenic
1075423873 10:122326930-122326952 AGTCTGGGGACTACAGTGCTTGG - Intronic
1076331561 10:129674311-129674333 AGTTTGGAAGCTGCATTGTTTGG + Intronic
1077314273 11:1910183-1910205 AGTCCGGCATTTGCATTGCTGGG - Intergenic
1081329307 11:41784816-41784838 TGTCTGGAGGCTTCATTACTAGG - Intergenic
1085328657 11:75628372-75628394 TGTCTTGCGGGTGCTTTGCTGGG - Intronic
1091161057 11:133420957-133420979 AGTCAGGTGGGTGCATGGCTGGG + Intronic
1091181132 11:133605692-133605714 AGTCCAGTGGCTGCAGTGCTTGG + Intergenic
1092165871 12:6341859-6341881 AGTGTGGCAGCGGCAGTGCTGGG + Exonic
1093410949 12:18865886-18865908 AGCCTGGCGGCTGAATTTTTGGG + Intergenic
1095169961 12:39022610-39022632 AGTCTGGGTGCTGCAGTGTTGGG - Intergenic
1095915817 12:47476743-47476765 AGTCTGGCGACTATATTCCTTGG - Intergenic
1096611972 12:52808029-52808051 AGTCTGGTGGAGGCATTGGTGGG - Intronic
1102325647 12:111980963-111980985 ACTCTGGAGGCTGCAGTGGTAGG + Intronic
1103731565 12:123031374-123031396 AGACAGGCGGATGCATCGCTGGG - Intronic
1104807132 12:131596806-131596828 GGTCTGGTGGCTACATTCCTGGG - Intergenic
1108704760 13:52974948-52974970 AGTCTTCCAGCTGCCTTGCTTGG + Intergenic
1112692785 13:101916248-101916270 TCTCTGGCGGCTGCACTTCTCGG + Intronic
1114050479 14:18916671-18916693 AGTTTGGTGGCTGCCTTGCCTGG - Intergenic
1114112078 14:19485261-19485283 AGTTTGGTGGCTGCCTTGCCTGG + Intergenic
1124595555 15:31088911-31088933 AGTCTGGTGGCAGAATTGCGTGG + Intronic
1124638858 15:31382574-31382596 TTTCTGGCTGCTGCATTTCTGGG + Intronic
1127396473 15:58547436-58547458 ACGCTAGCGGCTGCATTCCTTGG - Intronic
1128610596 15:69070065-69070087 AGTGTAGCGGCTGCATTCTTTGG - Intergenic
1130414063 15:83673458-83673480 AGTCTGTTGGCATCATTGCTGGG + Intronic
1130986988 15:88851091-88851113 AGGCTGGGGGCAGCATGGCTGGG - Intronic
1138481398 16:57305626-57305648 AGTCAGGCGGCTCAATTTCTTGG + Intergenic
1138677027 16:58658828-58658850 AGTGTGGTGGCTGCATTCTTGGG - Intergenic
1141955887 16:87371015-87371037 AGGCTGGTGGCTGCAGAGCTGGG - Intronic
1143314071 17:6018118-6018140 AATCTGGCGGCAGCTTAGCTGGG - Intronic
1151728561 17:75898046-75898068 AGTCTTGCGGCTGGATGGTTAGG - Intergenic
1152099838 17:78294603-78294625 ACCCTGGCGGCTGCAATGCCTGG + Intergenic
1153915732 18:9742466-9742488 AGTGTGGGGGCTGCTTGGCTCGG + Intronic
1154373878 18:13792479-13792501 AGTCAGGCAGTTTCATTGCTAGG - Intergenic
1156354493 18:36329572-36329594 AGTCTGGGGGCTGCAGTGATGGG + Intronic
1158513483 18:58111844-58111866 AGTCTGGCAGTTCCATTCCTAGG - Intronic
1158642154 18:59213050-59213072 AACCTGGGGGCTGCAGTGCTGGG + Intergenic
1164291143 19:23869660-23869682 AGTCTGCCACCTGGATTGCTTGG + Intergenic
1165102309 19:33446207-33446229 TGTCTGGCGGCTGCCGTGATGGG - Intronic
1165422714 19:35730300-35730322 AGTGAGGTGGCTGCATTGGTGGG - Intronic
1165527783 19:36370611-36370633 ACTCTGGCTGGTGCAGTGCTGGG - Intronic
1165840632 19:38787392-38787414 AGGAGGGCTGCTGCATTGCTAGG + Intergenic
925317105 2:2934851-2934873 AGTCAGGTGGCTGCAGTGCTGGG - Intergenic
926953488 2:18269516-18269538 CGTCTGGGGGCTCCATTTCTGGG + Intronic
938323636 2:130382502-130382524 AGCATGGCGGCTGCCTTGCTGGG + Intergenic
938762903 2:134441664-134441686 AGTGTGCCGCCTCCATTGCTAGG + Intronic
941170246 2:162127115-162127137 GCTCCTGCGGCTGCATTGCTTGG - Intergenic
944513132 2:200484114-200484136 GGTCTTGCTGCTGCAGTGCTTGG - Intergenic
945963158 2:216157048-216157070 AGTCTGGTGGCTTTGTTGCTGGG - Intronic
1169515769 20:6314593-6314615 AGTCTGGGTGCTGCAATGTTGGG - Intergenic
1170982347 20:21226576-21226598 AGTTGGGCGGCAGCAGTGCTAGG + Intronic
1171262081 20:23742949-23742971 AATCTGGGGGCTGCAATGTTGGG + Intergenic
1171503637 20:25614999-25615021 AGATTGGGGGCTGCATTGTTAGG + Exonic
1172566062 20:35931448-35931470 AGTGTGGCACCTGCAGTGCTGGG + Intronic
1172934958 20:38613496-38613518 GGTCTGGCTGGGGCATTGCTTGG + Intronic
1174411499 20:50339581-50339603 AGTCAGGAGGCTGGATTGCTGGG - Intergenic
1175161514 20:57011512-57011534 TGTCTCACGGCTGCACTGCTGGG - Intergenic
1180468955 22:15639045-15639067 AGTTTGGTGGCTGCCTTGCCTGG - Intergenic
1181568792 22:23755519-23755541 CGTCTGGCAGCTCCATTCCTGGG - Intergenic
1181924003 22:26343146-26343168 AGTCTGGAGGGTACATTGCCTGG - Intronic
1184454947 22:44604448-44604470 AGCCCGGCTGCTGCATTTCTGGG - Intergenic
1184455028 22:44605232-44605254 AGCCTGGCTGCTGTATTTCTGGG + Intergenic
1185119540 22:48957778-48957800 AATGTGGTGGCTGCAGTGCTGGG - Intergenic
950335120 3:12187385-12187407 TGCCTGGGGGCTGCATTCCTTGG - Exonic
950906863 3:16546384-16546406 AGGCGGGCGGCTGCACTGCTGGG - Intergenic
955141593 3:56275133-56275155 AGTCTGGCCCTTCCATTGCTTGG - Intronic
955192843 3:56777822-56777844 ACTCAGGCTGCTGCATTGCAGGG + Intronic
962045500 3:131755596-131755618 AATCTGACAGCTGCTTTGCTGGG + Intronic
966875149 3:184317348-184317370 ACTCGGGAGGCTGCACTGCTCGG - Exonic
971414875 4:26415607-26415629 AGTTTAGCTGCTGCATTTCTTGG - Exonic
972109833 4:35543622-35543644 AGTCTGGGTGCTGCAATGTTGGG - Intergenic
977265470 4:94848679-94848701 ATTCTGGCTGCTGCATGGATAGG + Intronic
983036050 4:162867133-162867155 AATCTGGGGGCTCCATTGTTAGG - Intergenic
984367701 4:178820361-178820383 AGCATGGCGCCAGCATTGCTGGG + Intergenic
985467528 5:12024-12046 AGGCTTGGGGCTGCATTGCAAGG - Intergenic
988588947 5:32532355-32532377 AGTCTCGTTGCTACATTGCTTGG - Intronic
988717270 5:33840682-33840704 AGTAAGGCTGCTGCATTCCTGGG - Intronic
989571579 5:42951054-42951076 AGTCCGGTGGCTGCGCTGCTGGG - Intergenic
992213160 5:74500687-74500709 ATTCTGGCGGCTGCATGGAGAGG + Intergenic
993246662 5:85460104-85460126 AGTCTGGAGGCTCCACGGCTGGG + Intergenic
994596103 5:101837566-101837588 AGTCTGGGTGCTGCATTGTTAGG + Intergenic
998133718 5:139663922-139663944 AGGCTGGAGGCTGCAGAGCTAGG + Intronic
999086101 5:148891596-148891618 AGTCTGCCAGCTGGATTGCAGGG + Intergenic
1001514409 5:172345332-172345354 TGTGTGGCGGCTGCTTTTCTAGG - Intronic
1002023519 5:176381581-176381603 AGTCTGGCGTCTGCCTTCTTTGG + Exonic
1007673531 6:43576185-43576207 AGTCTGGCGGCTGCATTGCTGGG + Exonic
1015811360 6:137164738-137164760 AGAGTGGCATCTGCATTGCTTGG - Intronic
1022644252 7:32215983-32216005 AGGCTGGTGGCTGCAATGCCAGG + Intronic
1024584376 7:50828776-50828798 ATTATGGAGGCTGCATTACTCGG + Intergenic
1028756455 7:94440646-94440668 AGTCTGGAGTCTGTATTACTGGG - Intergenic
1029677104 7:102077341-102077363 CGTCTGGCTGCTGCAGGGCTTGG - Intronic
1035670107 8:1410364-1410386 AGACTGGCGTCTGCTCTGCTGGG - Intergenic
1038144760 8:24884946-24884968 AATCTGGAAGCTGCTTTGCTGGG - Intergenic
1040549661 8:48428462-48428484 CGTCTGGCGCCTGCGTGGCTTGG + Intergenic
1040824171 8:51601389-51601411 AGTCTGGGTGCTCCATTGTTGGG + Intronic
1047903860 8:129452155-129452177 AGACTGGCGGTTCCATTTCTTGG + Intergenic
1052276913 9:26687035-26687057 AGACTGGAGGCTGCAGTTCTAGG - Intergenic
1053613571 9:39740886-39740908 AGTTTAGCTGCTGCATTTCTTGG + Intergenic
1053871612 9:42498843-42498865 AGTTTAGCTGCTGCATTTCTTGG + Intergenic
1054239943 9:62601511-62601533 AGTTTAGCTGCTGCATTTCTTGG - Intergenic
1054554076 9:66636037-66636059 AGTTTAGCTGCTGCATTTCTTGG - Intergenic
1055082186 9:72278250-72278272 AAGCTGGCCGCTGTATTGCTAGG - Intergenic
1055940288 9:81643049-81643071 AGAATGGCGGCTGCCTTGCGGGG + Intronic
1060936524 9:127519398-127519420 AGTCTGCCTGCTGCCTGGCTCGG - Intronic
1061087949 9:128410092-128410114 AGTCTGGAGGCAGCAGAGCTGGG + Intergenic
1061293966 9:129667028-129667050 AGGCTGGTGGCTGCGTTCCTTGG + Intronic
1195415655 X:104617324-104617346 AGTCTGGTGACTGCATGCCTTGG + Intronic
1196058050 X:111377378-111377400 AGTCTGGCAGCTGCAAGGCCTGG - Intronic
1198817824 X:140611576-140611598 TGTCTGGCCGCTCCAGTGCTAGG + Intergenic