ID: 1007679782

View in Genome Browser
Species Human (GRCh38)
Location 6:43626144-43626166
Sequence CCCCTCAGGCCCTAGGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007679774_1007679782 9 Left 1007679774 6:43626112-43626134 CCTTTGTCAAGAGAAGGAAAGTC 0: 1
1: 0
2: 2
3: 24
4: 271
Right 1007679782 6:43626144-43626166 CCCCTCAGGCCCTAGGTAACTGG 0: 1
1: 0
2: 0
3: 16
4: 134
1007679768_1007679782 24 Left 1007679768 6:43626097-43626119 CCTCCCCACTTCAGCCCTTTGTC 0: 1
1: 0
2: 1
3: 27
4: 347
Right 1007679782 6:43626144-43626166 CCCCTCAGGCCCTAGGTAACTGG 0: 1
1: 0
2: 0
3: 16
4: 134
1007679773_1007679782 10 Left 1007679773 6:43626111-43626133 CCCTTTGTCAAGAGAAGGAAAGT 0: 1
1: 0
2: 3
3: 24
4: 364
Right 1007679782 6:43626144-43626166 CCCCTCAGGCCCTAGGTAACTGG 0: 1
1: 0
2: 0
3: 16
4: 134
1007679767_1007679782 25 Left 1007679767 6:43626096-43626118 CCCTCCCCACTTCAGCCCTTTGT 0: 1
1: 0
2: 2
3: 46
4: 464
Right 1007679782 6:43626144-43626166 CCCCTCAGGCCCTAGGTAACTGG 0: 1
1: 0
2: 0
3: 16
4: 134
1007679769_1007679782 21 Left 1007679769 6:43626100-43626122 CCCCACTTCAGCCCTTTGTCAAG 0: 1
1: 0
2: 4
3: 11
4: 186
Right 1007679782 6:43626144-43626166 CCCCTCAGGCCCTAGGTAACTGG 0: 1
1: 0
2: 0
3: 16
4: 134
1007679770_1007679782 20 Left 1007679770 6:43626101-43626123 CCCACTTCAGCCCTTTGTCAAGA 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1007679782 6:43626144-43626166 CCCCTCAGGCCCTAGGTAACTGG 0: 1
1: 0
2: 0
3: 16
4: 134
1007679771_1007679782 19 Left 1007679771 6:43626102-43626124 CCACTTCAGCCCTTTGTCAAGAG 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1007679782 6:43626144-43626166 CCCCTCAGGCCCTAGGTAACTGG 0: 1
1: 0
2: 0
3: 16
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007679782 Original CRISPR CCCCTCAGGCCCTAGGTAAC TGG Intronic
900681854 1:3920716-3920738 GCCCTCAGCCCCTATGTAGCTGG + Intergenic
900990655 1:6096804-6096826 CCCAGCTGGCCGTAGGTAACAGG + Intronic
900992950 1:6106394-6106416 CCCCTGGGGCCCTATGTGACCGG - Exonic
904824999 1:33268604-33268626 TCCCTCAGGCCCCAGCTTACAGG - Intronic
904976671 1:34461880-34461902 CCCCTCAGGCTCTGGGGAACTGG + Intergenic
907002260 1:50873359-50873381 CCCCTATGGCCCTGGGTAAATGG + Intronic
909322499 1:74307409-74307431 CCCCTTAGGCTCAAAGTAACAGG + Intronic
910223331 1:84912051-84912073 CACCTCAGCCCCCAGGTAGCTGG + Intergenic
913994529 1:143640965-143640987 TGCCTCAGGCCCTAAGTAGCTGG - Intergenic
915143216 1:153779459-153779481 TTCCTCAGGCTCCAGGTAACCGG + Exonic
917717412 1:177752422-177752444 ACCCTCAGGCCCAGGGGAACAGG + Intergenic
921575400 1:216829666-216829688 TGCCTCAGCCCCTAGGTAGCTGG + Intronic
923282936 1:232462014-232462036 GCCCTCAGCCCCTAGGAGACAGG - Intronic
924774247 1:247104466-247104488 CCCCTCAGGCCCTGAGTGACAGG + Intergenic
1064858739 10:19801297-19801319 CACCTCAGCCCCTAGGTAGCTGG - Intergenic
1065115814 10:22481519-22481541 CACCTCAGCCCCCAAGTAACTGG + Intergenic
1067539202 10:47139506-47139528 CGCCTCAGGCCCTCGGTAAAAGG + Intergenic
1076168035 10:128297879-128297901 CCCCTTAGGGCCTAGGCATCTGG + Intergenic
1077289422 11:1782050-1782072 CCCCCCAGGCCCCAGGGAGCAGG + Intergenic
1077575442 11:3379269-3379291 CCCCTCAGGCCCTGAGTGACAGG + Intergenic
1078208852 11:9253750-9253772 CACCTCAGCCTCTAGGTAGCTGG - Intronic
1083994213 11:66264216-66264238 CCTCTCAGCCCCAAGGTACCAGG - Exonic
1084450663 11:69234785-69234807 CCCCACAGGCCCTAGGACGCTGG + Intergenic
1084606513 11:70175460-70175482 CCCCTGAGGCCCTGGGTGGCTGG + Intronic
1085921953 11:80967963-80967985 CCACTCTGGCCTTAGGAAACTGG + Intergenic
1086416350 11:86592333-86592355 CCCCTCAAGGCCTAAGAAACTGG - Intronic
1087259660 11:95996455-95996477 CCCTTCAGACCCTAGGGAAAAGG - Intronic
1087725931 11:101716578-101716600 CCCTTCAGGCCCTATTTTACAGG + Intronic
1088247732 11:107835542-107835564 CACCTCAGCCCCCAAGTAACTGG + Intronic
1088420043 11:109635745-109635767 CCCCTGAGGCCCTAAGAACCAGG - Intergenic
1089694046 11:120205449-120205471 CCCGTCATGCCCTAGCTACCTGG + Intergenic
1090083614 11:123631712-123631734 CACCTCAGCCCCCAGGTAACTGG - Exonic
1091173136 11:133536229-133536251 CCCATCTGGCCCTAGGAAGCTGG - Intergenic
1092281534 12:7101381-7101403 CCCCTCAGTCCCTGAGTAGCTGG + Intronic
1096595092 12:52690080-52690102 CTCCTCAGGCCCGAGGCACCTGG + Exonic
1096644319 12:53021798-53021820 GCTCTCAGTCTCTAGGTAACAGG + Exonic
1096746830 12:53734331-53734353 CACCTCAGCCCCTAAGTAGCTGG - Intergenic
1097985601 12:65780125-65780147 GCCCTCAGGCCCTAGCCACCTGG - Intergenic
1107064771 13:36201180-36201202 CACCTCAGTCCCCAGCTAACAGG + Intronic
1114265573 14:21070882-21070904 CCCATCCGGCCCTAGGGGACTGG + Intronic
1116129103 14:40830518-40830540 AACCTCAGGCCCAAGGTAAATGG + Intergenic
1116493750 14:45536512-45536534 CCCCTCAGGCGCTTGGTACCAGG + Intergenic
1119873568 14:78037186-78037208 CCCCTCAGAACCAAGGAAACTGG - Intergenic
1119881249 14:78101607-78101629 CCACTGAGGCCCTAGCTAGCAGG - Intergenic
1124493994 15:30175414-30175436 CCACTCAGGCCCTGGGTGTCAGG - Intergenic
1124749575 15:32363232-32363254 CCACTCAGGCCCTGGGTGTCAGG + Intergenic
1125092550 15:35811242-35811264 CTCCTCAGGCCCCAGTTAAAAGG - Intergenic
1129737381 15:77973888-77973910 CCCCTCAGCCCCTGGGTCAGAGG + Intergenic
1130253227 15:82314209-82314231 CCCCTCAGCCCCTGGGTCAGAGG + Intergenic
1133174957 16:4007433-4007455 GTCCTCAGGCCCTAGGGGACAGG - Exonic
1134901096 16:17938722-17938744 CACCTCTGGCCTTAGCTAACTGG + Intergenic
1141392968 16:83680138-83680160 TCCTTCAGGCTCTAGGTCACAGG + Intronic
1144774907 17:17780511-17780533 CCCCTCAGGGCCTAGGACAGGGG + Intronic
1147542011 17:41368270-41368292 CCCCTCAGTCCTAAGTTAACTGG - Intronic
1148914306 17:50961517-50961539 CCCCTTAGTCCCTGGGGAACAGG - Intergenic
1151227447 17:72657605-72657627 CCCCTCAGTCCCTGGTGAACCGG - Intronic
1152231642 17:79116968-79116990 CTTCTCAGGCCCTAGGTCAGTGG - Intronic
1152657658 17:81527451-81527473 CCCCTCAGGCTCTGGGGAAGGGG + Intergenic
1152799329 17:82323610-82323632 CCGCTCAGGGCCTAGGGAGCAGG + Intronic
1157452892 18:47801348-47801370 ACCCTCAGGCCTTGGCTAACTGG - Intergenic
1157596887 18:48869603-48869625 CCCCTCAGTCCCTTAGTACCTGG - Intergenic
1161354068 19:3809451-3809473 CCCCTCGTGCCCTCGGGAACTGG - Intronic
1161933482 19:7356633-7356655 CCTCTCATGCCCTACGTACCAGG - Intronic
1163553209 19:17977453-17977475 CACCTCAGCCCCCAGGTAGCTGG + Intronic
1165675509 19:37719384-37719406 CTCCTCAGGCCCTAGGGTGCTGG - Exonic
1166783215 19:45352932-45352954 CCCCTCTGTCCCTAGGCACCCGG - Intronic
1168520567 19:57047237-57047259 CCCCTCTGACCCTAGCCAACAGG + Intergenic
1202649824 1_KI270706v1_random:170102-170124 CCCCTCAGGCTGTAGGAATCTGG - Intergenic
925048927 2:796227-796249 TCCCTCAGGCCCCTGGGAACAGG + Intergenic
925953692 2:8939616-8939638 CCACACAGGTCCTAGGAAACGGG + Intronic
926226358 2:10969821-10969843 CCCCTCTGGCCATAGTTAATTGG - Intergenic
938281414 2:130066113-130066135 CCACTCAGGCTGTAGGAAACTGG + Intergenic
943541094 2:189215261-189215283 ACCCTCAGTCCCAAGGAAACTGG + Intergenic
946538355 2:220657149-220657171 ACCCTCTACCCCTAGGTAACAGG - Intergenic
1169330851 20:4715075-4715097 CCCCTCAGTCCCTGGCGAACTGG + Intergenic
1171881541 20:30621164-30621186 CCCCTCAGGCTATAGGAATCTGG + Intergenic
1174417819 20:50379202-50379224 CCCCTCAGGACCCAGGGAGCTGG - Intergenic
1175088896 20:56485549-56485571 TGCCTCCGGGCCTAGGTAACGGG - Intronic
1175094032 20:56527709-56527731 CCCCTGAGGCCCCAGGCATCTGG - Intergenic
1176601995 21:8802445-8802467 CCCCTCAGGCTGTAGGAATCTGG + Intergenic
1177095160 21:16823473-16823495 CGCCTCAACCCCTAAGTAACTGG + Intergenic
1177882911 21:26715655-26715677 ACTCTCAGGCCCTAGGTCGCTGG - Intergenic
1179283240 21:39952958-39952980 CCCCTCAGTCCCTGGAAAACCGG + Intergenic
1180344279 22:11693996-11694018 CCCCTCAGGCTGTAGGAATCTGG + Intergenic
1183469040 22:37996156-37996178 CCCCTGAGGACCTAGGGAAGAGG + Intronic
1185289762 22:50017447-50017469 CCCATCAGGCCCTGGGTGCCTGG - Intronic
950100836 3:10355710-10355732 CCCCTCAGGCCCTGGGCATGGGG + Intronic
950132008 3:10553813-10553835 CCACCCAGGCCCTTAGTAACGGG - Intronic
954312549 3:49781548-49781570 CTCCACAGGCCATAGGTCACTGG + Intronic
954407877 3:50355540-50355562 CTCCTCTGGCCCCAGGCAACTGG - Exonic
956349634 3:68320622-68320644 CACCTCTGGCCCTGGGTCACAGG - Intronic
957105884 3:75886510-75886532 CCCCAGAGTCCCCAGGTAACAGG + Intergenic
960270597 3:115669879-115669901 CCCCTCATACCCTAGGTATGAGG + Intronic
961322965 3:126090964-126090986 CCTCTCAGGTCCTAGGCAGCTGG - Intronic
962395615 3:135013229-135013251 CCTCTCAGGACCTTAGTAACAGG + Intronic
962509299 3:136083126-136083148 CACCTCAGCCCCTAAGTAGCTGG + Intronic
966378644 3:179322737-179322759 CCCTTCAAGCCCTGGGGAACTGG - Intergenic
966767725 3:183478193-183478215 CCCCCCAGGCCCTGGGTTCCTGG - Intergenic
973365320 4:49204252-49204274 CCCCTCAGGCTGTAGGAATCTGG + Intergenic
973395271 4:49588202-49588224 CCCCTCAGGCTGTAGGAATCTGG - Intergenic
974874399 4:67685626-67685648 CCCATTAGGTCCTACGTAACGGG - Intronic
978861096 4:113450074-113450096 CACCTCAGGCCCCAGTGAACAGG - Intergenic
981824301 4:148922425-148922447 CAACTCAGCCCCTAGGTGACTGG - Intergenic
982751416 4:159166604-159166626 CCCCACAATCCCTAGGAAACTGG - Intronic
984255770 4:177388320-177388342 CACCTCAGCCCCTGGGTAGCTGG + Intergenic
986723642 5:10578233-10578255 CCCCTCTGTCCCCAGGAAACTGG + Intronic
992443671 5:76815938-76815960 CACCTCAGGCCCTGAGTAGCTGG - Intergenic
995760402 5:115556049-115556071 CCCCTCAGTCCCTAGGTCCTGGG + Intergenic
996738546 5:126778205-126778227 CCCCTCAGGCCCCAGGTGCGGGG + Intronic
997384141 5:133459167-133459189 CCTCTCAGGCCCAAGGAAATGGG - Intronic
1002638278 5:180618729-180618751 CCCGTCAGGCACTAGGAAAAGGG + Intronic
1005988382 6:30888703-30888725 CCCCTTAGGCCCGAGGGATCAGG + Intronic
1006429665 6:33988069-33988091 CCCCTCTGGCCCCGGGTACCTGG + Intergenic
1007679782 6:43626144-43626166 CCCCTCAGGCCCTAGGTAACTGG + Intronic
1007944136 6:45810278-45810300 CCCCTCAGTCCCAAGCAAACTGG + Intergenic
1008486506 6:52041822-52041844 CCCCTCAGTCCCAAGCAAACTGG + Intronic
1009862382 6:69351205-69351227 TCCCTCAGCCCCCAGGTAGCTGG + Intronic
1017163812 6:151390359-151390381 CCCCTCAGCCCCTCGGGGACGGG - Intronic
1019378576 7:709779-709801 CACCTCAGCCCCTGGGTAGCTGG + Intronic
1021062548 7:16131694-16131716 TGCCTCAGCCCCCAGGTAACTGG + Intronic
1023845034 7:44115758-44115780 CCCCTGACACTCTAGGTAACAGG - Exonic
1026009378 7:66625004-66625026 CACCTCAGCCCCCAGGTAGCTGG - Intergenic
1029191341 7:98774350-98774372 ACCCTCATGCCTTGGGTAACTGG + Intergenic
1029270739 7:99375218-99375240 CCCCGCCGGCCCGAAGTAACGGG - Intronic
1037100069 8:15033198-15033220 CCCCTGTGGCCCTAGGAATCAGG + Intronic
1037309357 8:17537842-17537864 GCCCTCAGCACCTTGGTAACCGG - Intronic
1038733977 8:30152508-30152530 CACCTCAGGCCCCAAGTAGCTGG + Intronic
1039378524 8:37061867-37061889 CCCCTCAGCTCATAGCTAACAGG - Intergenic
1039408476 8:37332428-37332450 CCCCTAAGATCCTAGTTAACAGG + Intergenic
1041677522 8:60550496-60550518 CACCTCAGCCCCCATGTAACTGG + Intronic
1041715072 8:60924897-60924919 CACCTCAGCCCCTAAGTCACTGG + Intergenic
1041805203 8:61841964-61841986 CCCCTAAGGCTCTAGATACCAGG + Intergenic
1045059314 8:98398406-98398428 CCCCTCAGTCCCGAGCAAACTGG + Intergenic
1045317184 8:101053228-101053250 CTCCTCAGACGCTAGCTAACAGG + Intergenic
1049133478 8:140871751-140871773 CACCTCTAGTCCTAGGTAACTGG + Intronic
1051546393 9:18280310-18280332 CCCCTTAGGCCCTAGGTTCCAGG - Intergenic
1051726197 9:20089728-20089750 TCCCTCAGGCCAAAGGTAGCAGG - Intergenic
1055490814 9:76803914-76803936 CCCCTGGGGCCCTAGACAACTGG + Intronic
1057638759 9:96796714-96796736 CAACTCAGGCCCCAGGGAACAGG - Intergenic
1058390955 9:104495242-104495264 GCACACAGGCCCAAGGTAACAGG - Intergenic
1060453787 9:123769961-123769983 CCCCTCTGTTCCTAGGTAACAGG - Intronic
1061664327 9:132151654-132151676 CCCCTCAGGGCCCAGGTCACTGG - Intergenic
1062253963 9:135612444-135612466 CCCCTAAGGCCCAAGCAAACAGG + Intergenic
1188768878 X:34129393-34129415 CACCTCAGCCCCCAGGTAGCTGG + Intergenic
1193134635 X:77956909-77956931 CACCTCAGCCCCCAGGTAGCTGG + Intronic
1202120013 Y:21511423-21511445 GCCCTCAGGCCGTACGTAACCGG - Exonic
1202122464 Y:21534964-21534986 GCCCTCAGGCCGTACGTAACCGG - Exonic
1202156541 Y:21894419-21894441 GCCCTCAGGCCGTACGTAACCGG + Exonic
1202158989 Y:21917960-21917982 GCCCTCAGGCCGTACGTAACCGG + Exonic
1202185438 Y:22182875-22182897 GCCCTCAGGCCGTACGTAACCGG + Exonic
1202197423 Y:22308908-22308930 GCCCTCAGGCCGTACGTAACCGG - Intronic