ID: 1007683217

View in Genome Browser
Species Human (GRCh38)
Location 6:43648759-43648781
Sequence CTGTGGAAGTGGTTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007683217 Original CRISPR CTGTGGAAGTGGTTGGATTC TGG Intronic
900523715 1:3118467-3118489 AGCTAGAAGTGGTTGGATTCCGG + Intronic
902915475 1:19636360-19636382 CTGTGCATGTGGTTGGAGACTGG + Intronic
902963488 1:19980973-19980995 CTGTGTAAGGGGTTGGACTGTGG + Intergenic
904091093 1:27945609-27945631 CTGTGGAATCAGTTGGACTCAGG - Intronic
904480114 1:30788156-30788178 CCATGGAAGTGGTCGGATCCTGG - Intergenic
904873018 1:33633632-33633654 CTGGGGAAGTTGTTGGTTCCTGG + Intronic
905460098 1:38117049-38117071 ATGGGCAAGTGTTTGGATTCTGG + Intergenic
905972340 1:42151507-42151529 CTGGGGAAATGGTTGGTTTTAGG + Intergenic
906569113 1:46821046-46821068 ATGTGGCAGTGTTTGGAGTCTGG + Intergenic
907720651 1:56968963-56968985 CTGTGGAACTGGGTGGAGCCTGG - Intergenic
907822087 1:57980195-57980217 GTGTGGTAGTGGTTGGAGTTGGG - Intronic
908122612 1:61000387-61000409 TAGTGGACATGGTTGGATTCTGG - Intronic
908164550 1:61445571-61445593 CTGAGGATGTGGTAGGATTTAGG - Intronic
908571805 1:65419323-65419345 CTTTGGAGGAGGTTGGATTCTGG - Intergenic
909662810 1:78102902-78102924 CTCTGGCACTGTTTGGATTCTGG + Intronic
909898384 1:81102889-81102911 AAGTGCAAGCGGTTGGATTCAGG + Intergenic
910904534 1:92161046-92161068 CTGTGCCAGGGGTAGGATTCTGG + Intergenic
912254694 1:108046981-108047003 CTGTGGCATTGGTTGGAGCCTGG - Intergenic
912768568 1:112439819-112439841 CCCTGGAAGTGGGTGGGTTCTGG - Intronic
915890039 1:159764717-159764739 CTGAGGAACAGGTTGGATTTAGG - Intergenic
916064633 1:161126220-161126242 ATGTGGCAGTGGATGGATTTAGG - Intronic
916560600 1:165931361-165931383 GTTGAGAAGTGGTTGGATTCTGG - Intergenic
916709342 1:167389619-167389641 CTGTGGAAGTGTCTGAATTGGGG - Exonic
916910227 1:169338438-169338460 CTGTGGAAATGGTTCTTTTCTGG - Intronic
917659449 1:177163745-177163767 GTGTGGATGTGGTTGAATTAGGG + Intronic
918773416 1:188594815-188594837 CTGTGGAAGGGATTCGATTAGGG + Intergenic
1062815879 10:499691-499713 CTGGGGAGGTGATTGGATCCTGG - Intronic
1064723125 10:18250073-18250095 CTTGAGAAGTGGTAGGATTCTGG - Intronic
1064774773 10:18764273-18764295 TGGTGGAAGTGGTCAGATTCAGG + Intergenic
1066105433 10:32152277-32152299 TGGTTGAAGTGGTTTGATTCAGG + Intergenic
1066418862 10:35246125-35246147 CGGTGGAAGTGATTGGATCATGG - Intergenic
1066423740 10:35285784-35285806 TTATGGATGTGGTTGGATTTAGG + Intronic
1066488912 10:35875206-35875228 CAGTGGGAGTTGTTGGCTTCTGG + Intergenic
1066758361 10:38732248-38732270 CTGGGGAATTGCTTGAATTCGGG - Intergenic
1067308991 10:45094512-45094534 CAGTGGGAGTTGTTGGCTTCTGG + Intergenic
1067519370 10:46984784-46984806 CTGTTGAAGTTGTCTGATTCTGG + Intronic
1067642877 10:48067055-48067077 CTGTTGAAGTTGTCTGATTCTGG - Intergenic
1068392934 10:56422852-56422874 CTGTGGAAGTAACTGGATTCTGG + Intergenic
1068581197 10:58741771-58741793 CTGTTGAAATTGTTGGATTTAGG + Intronic
1069605333 10:69735417-69735439 CTGTGGAAGGGGCTGGCTGCTGG - Intergenic
1070670378 10:78373489-78373511 CTGTGGAAGAGGTTAGGTGCTGG + Intergenic
1071374423 10:84988240-84988262 CTGTGGAACCGGCTGTATTCAGG - Intergenic
1072276346 10:93827006-93827028 CTGTGGAATTTGGTGCATTCTGG - Intergenic
1072517730 10:96202388-96202410 CAGTGAGAGTGGTTGGATTCTGG + Intronic
1072839090 10:98750574-98750596 CGGTAGAAGTGGTTGGTTTCTGG + Intronic
1074596894 10:114876206-114876228 CTGAGGAAAGGGTTGGAGTCAGG - Intronic
1075610680 10:123852391-123852413 GGTTGGAAGTGGTTGGATTTAGG - Intronic
1075656846 10:124167751-124167773 CTGTGGACGTGGTTGGCCTGAGG + Intergenic
1075662852 10:124210127-124210149 CTGTGGAAATGCTTGGATTCTGG + Intergenic
1076766223 10:132635228-132635250 CTGTTGATGTGGTTGAATTGGGG + Intronic
1077051027 11:567107-567129 CTGTGGAACTGGATGTTTTCAGG - Intergenic
1078894100 11:15582947-15582969 CTGTGGAAGGGGGTGGCTTGAGG + Intergenic
1079306840 11:19330771-19330793 ATGAGGGAGTGATTGGATTCTGG + Intergenic
1081476772 11:43441010-43441032 CTCTCTAAGTGCTTGGATTCAGG - Intronic
1081564299 11:44247980-44248002 TTTGGGAAGTGGTTGGGTTCTGG + Intergenic
1081651578 11:44827467-44827489 CTGGGGAAGTGCCTGGAGTCTGG + Intronic
1082543246 11:54289979-54290001 CTGTGGATGTCGTTGGAAACGGG + Intergenic
1083479392 11:62933929-62933951 CTCTGGATGTGGCTGGAGTCAGG + Intergenic
1085056427 11:73406851-73406873 CTGTGGAAGTTGTTGTGCTCTGG + Intronic
1085391791 11:76185882-76185904 GTTGAGAAGTGGTTGGATTCTGG - Intergenic
1085875578 11:80403310-80403332 CTATGGCAGTGGTGGGAGTCAGG + Intergenic
1085907403 11:80780626-80780648 CTTTGGCAGTGGAGGGATTCTGG + Intergenic
1086985152 11:93239700-93239722 CAGTGGAAGTGGTTCCAATCAGG - Intergenic
1087227322 11:95615638-95615660 ATGTGGCAGAGTTTGGATTCAGG - Intergenic
1087671439 11:101111800-101111822 ATTTGGAAGTGATTGGATTTTGG + Intronic
1092014156 12:5143083-5143105 ATGTGGAGGTGATTGGATTACGG - Intergenic
1092255114 12:6922637-6922659 GTGTGGGGGTGGTTGGAGTCTGG + Intronic
1092711954 12:11348340-11348362 CCCTGGAACTGGTTTGATTCAGG - Intergenic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1093779912 12:23123030-23123052 AGGTGGAAGTAGTTGGATTCTGG + Intergenic
1097147707 12:56953207-56953229 CTTTGGAATTGGTAGGATTTAGG - Intronic
1097835619 12:64270061-64270083 CTGTGAAAATGGTAGGATTTTGG - Intronic
1097878176 12:64662815-64662837 CTGTGGAAGAAGGTGGATTCTGG + Intronic
1098382234 12:69881401-69881423 CTGGGGAAGTGGTGGGATGGGGG - Intronic
1099338533 12:81396854-81396876 CAATGGAAGTGGTAGGATTCTGG + Intronic
1101247581 12:102899357-102899379 CTGTGGAAGTGGATGCTTCCAGG - Intronic
1102503820 12:113371513-113371535 CTGGGGAAGTGGTCAGATGCTGG + Intronic
1106752939 13:32793718-32793740 CAGTGGAGGTGGTTAGATCCTGG - Intergenic
1110640270 13:77815802-77815824 TTGTGGAAGTGGTGTGGTTCTGG + Intergenic
1110685074 13:78362866-78362888 CTTTGGAAGTGATTAGATTAAGG - Intergenic
1114366195 14:22029338-22029360 CTGTGGAAAGTGTTGGATTTTGG + Intergenic
1116098030 14:40396873-40396895 GTGGGGAAGTGATTGGATTATGG + Intergenic
1116632396 14:47352325-47352347 TTGTGGAAGGGGTTGGAGTTTGG - Intronic
1116889889 14:50257958-50257980 ATCTGGGAGGGGTTGGATTCAGG + Intronic
1118432464 14:65733730-65733752 GTGTAGAAATGGATGGATTCTGG - Intronic
1119037281 14:71241189-71241211 CTGAGGAGGTGGTTGGATCCTGG - Intergenic
1119780590 14:77274433-77274455 CTGTGGAACTGGGGGGCTTCTGG - Intergenic
1121692164 14:95885726-95885748 CTGTGGGAGGGGTTTGACTCAGG + Intergenic
1121988634 14:98532545-98532567 CAGTGAAAGTGATTGGACTCAGG - Intergenic
1122105415 14:99450067-99450089 CTGTGGCAGAGGTTGTATACAGG - Intronic
1122610472 14:102979051-102979073 GTGTGGAAGGAGTTGGAGTCTGG + Intronic
1123630118 15:22255384-22255406 CTGTGGAAGTCCTTGGATCAAGG - Intergenic
1123829279 15:24117373-24117395 CTAAGGAAGTGGTTGGATGATGG - Intergenic
1124068737 15:26371305-26371327 GGCAGGAAGTGGTTGGATTCTGG - Intergenic
1124158487 15:27249115-27249137 CTGTTGAAGTGACTGGACTCAGG + Intronic
1124204355 15:27704423-27704445 GTAGGGAAGTGGTTGGATTATGG + Intergenic
1125556949 15:40593996-40594018 CTATGGAAGTGATTGGACTTTGG - Intergenic
1125753443 15:42046075-42046097 CAGTAGGAGTGGATGGATTCTGG - Intronic
1125772390 15:42178251-42178273 CTGGAGAAGTTGTTGGATTTGGG + Exonic
1126321928 15:47434314-47434336 CTGTTGAAATGGGTGCATTCTGG + Intronic
1126975121 15:54169345-54169367 TTTAGGAAGAGGTTGGATTCTGG - Intronic
1129004699 15:72362833-72362855 CGATGGAAGTGTTTTGATTCAGG - Intronic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129337085 15:74859063-74859085 CTCCGAAAGTGGTGGGATTCAGG + Intronic
1129609247 15:77039826-77039848 CTGTGAGAGTGGTTGGAATTAGG - Intergenic
1130382261 15:83380589-83380611 TTGGGGAGGTGGTAGGATTCTGG + Intergenic
1131159925 15:90099044-90099066 GTGAAGAAGTGGTTGGATTCTGG - Intronic
1132239656 15:100248089-100248111 CTGTGGAGGAGCTTGGAGTCTGG - Intronic
1132983093 16:2749262-2749284 CTGTGGGAGGGGTTGGATGGGGG + Intergenic
1133309921 16:4838492-4838514 CTGTTGAACCGGTTGGTTTCTGG + Intronic
1133795732 16:9044740-9044762 CTGTGGACATGGCTGGATCCAGG + Intergenic
1135462833 16:22659955-22659977 CTGTGGGAGTGGGAGGATCCCGG + Intergenic
1135824036 16:25710512-25710534 CTGTGGAGCAGGTTGGAGTCTGG + Intronic
1136452755 16:30363237-30363259 GGGGAGAAGTGGTTGGATTCTGG - Intronic
1137703782 16:50519379-50519401 CTCAGGAAGTGGTTCCATTCTGG - Intergenic
1137730790 16:50688100-50688122 TTGTGGAAGTGTTTGGACTTTGG + Intergenic
1138000121 16:53269791-53269813 CTGTGGTAGGGGTGGGATTGGGG - Intronic
1139556705 16:67716559-67716581 CTGTGGAACTGGATGGACTGTGG - Intronic
1141100461 16:81193956-81193978 CTGTGGGAGAAGGTGGATTCTGG - Intergenic
1141288961 16:82699728-82699750 CTGTGGCACTGTTTGGATTGTGG - Intronic
1141972975 16:87495271-87495293 CTGTGGAAGTCCTTGGATCAAGG + Intergenic
1142431338 16:90029563-90029585 CCGAGGCACTGGTTGGATTCGGG + Intronic
1143034058 17:3984326-3984348 CTTTGGAAGTGGTTGGACCCAGG - Intergenic
1143727635 17:8860420-8860442 CTGGGGATGGGGATGGATTCGGG - Intronic
1145492769 17:23854262-23854284 CTGAGGAATTCGTTGGATACGGG + Intergenic
1145596587 17:25364737-25364759 CTGAGGAATTCGTTGGATACGGG + Intergenic
1145614361 17:25623839-25623861 CTGAGGAATTCGTTGGATACGGG + Intergenic
1145793750 17:27643922-27643944 CTGTGGCAGTGGTTGGGTGTAGG - Intronic
1151823410 17:76509715-76509737 CTGGGGAAGTGGCTGGCTCCAGG + Intergenic
1152845958 17:82599908-82599930 CTGTGTTTGTGGTTGGGTTCAGG + Intronic
1153946975 18:10027092-10027114 CTGAGAAAGAGGTTGGATCCGGG + Intergenic
1156103389 18:33626417-33626439 TTATGAAAGTGGTGGGATTCAGG + Intronic
1156282837 18:35657748-35657770 CTGTGGAAGTCAGTGGATTCTGG + Intronic
1159413382 18:68110613-68110635 CTCTGGAGGTGGTTGCAGTCAGG - Intergenic
1159486821 18:69071824-69071846 CTGTGAAAGTGGTTGGGATTTGG - Intergenic
1160797313 19:951876-951898 CTCTCGAAGTGCTGGGATTCTGG - Intronic
1160993156 19:1869217-1869239 CTCTGGAAGTGCTGGGATTACGG - Intergenic
1162620126 19:11836344-11836366 ATGAGGCAGGGGTTGGATTCAGG - Intergenic
1162624251 19:11871530-11871552 ATGAGGCAGGGGTTGGATTCAGG - Intronic
1162874089 19:13608036-13608058 TGCAGGAAGTGGTTGGATTCAGG - Intronic
1163577679 19:18120189-18120211 CTGTGAAAGAGGTTGCATTTAGG + Intronic
1165322719 19:35096200-35096222 ACGTGGCAGTGGTTGGAATCAGG + Intergenic
1167242847 19:48355392-48355414 CTGTGGAAGAGCTTGGAGGCAGG + Intronic
1168313316 19:55472585-55472607 CCTTGGAAGTGGGTGGACTCTGG + Intergenic
926144832 2:10390676-10390698 CTGGGCAAGAGGTTGGATACTGG + Intronic
926738146 2:16090026-16090048 CTGTGGAGGTGGCTGGAATTTGG + Intergenic
926738165 2:16090122-16090144 CTGTGGAGGTGGCTGGAATTTGG + Intergenic
926738184 2:16090218-16090240 CTGTGGAGGTGGCTGGAATTTGG + Intergenic
926738203 2:16090314-16090336 CTGTGGAGGTGGCTGGAATTTGG + Intergenic
926738223 2:16090410-16090432 CTGTGGAGGTGGCTGGAATTTGG + Intergenic
928289079 2:30021573-30021595 CTGCAGAAGTTCTTGGATTCAGG - Intergenic
929902881 2:46021070-46021092 CTGTGGAACAGGGTGGATGCTGG + Intronic
930571494 2:53092016-53092038 CTTTGGAAGTGGGTAGAGTCTGG - Intergenic
932155176 2:69410129-69410151 CTGTCAAAGTGGTGGGATTATGG - Intronic
933909645 2:86928568-86928590 AGGTGAAAGTGGTTGGATTGTGG + Intronic
936679525 2:114754137-114754159 CTGTGGCTTTGGTTGGCTTCAGG + Intronic
941490996 2:166142123-166142145 CTGTGGAAGTGGCTAGAGTCTGG + Intergenic
948117973 2:235507719-235507741 CTTCAGAAGTGGGTGGATTCAGG - Intronic
948367814 2:237469882-237469904 CTCTAGCAGTGGTTGGGTTCAGG - Intergenic
1169313742 20:4570858-4570880 CAGTGGAAGTGGCAGGATGCTGG - Intergenic
1169892190 20:10465329-10465351 AAGTGGGAGTGGCTGGATTCCGG - Intronic
1170089531 20:12575471-12575493 TTGTGGATGTGGCTGGCTTCAGG + Intergenic
1170175160 20:13460760-13460782 ATGGGAAAGTGATTGGATTCCGG - Intronic
1170535635 20:17338092-17338114 GTGTGGAAGTGCTTGAGTTCAGG - Intronic
1170679785 20:18516107-18516129 AGGGGGAAGTGGGTGGATTCTGG - Intronic
1171578871 20:26373965-26373987 TTGTGGAATTCGTTGGAATCGGG + Intergenic
1172106358 20:32519473-32519495 CTGTGGAAGTTGCTGAAGTCAGG - Intronic
1173631303 20:44518048-44518070 CTGTGAAAATGGTCAGATTCTGG - Intronic
1173817653 20:46000162-46000184 CAGTGGAAGGGGCTGGATGCTGG - Intergenic
1174337789 20:49875624-49875646 ACTTGGAAGTGGTTGGAGTCGGG + Intronic
1174556619 20:51400131-51400153 CAGTGGAGGTTGTTGGTTTCTGG - Intronic
1174619275 20:51861847-51861869 CTGGGGAAGTGTTTAGTTTCTGG + Intergenic
1177310438 21:19385456-19385478 ATGTGGAAGAGATTGGCTTCAGG + Intergenic
1180122257 21:45761688-45761710 CTGTGGGTGTGGTTGGTCTCTGG + Intronic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1181257409 22:21572716-21572738 CTCTGGAAGTGGTTGGAGTCTGG - Intronic
1181287840 22:21767217-21767239 GTGTGAAAATGGTTGGATCCTGG + Intronic
1181931220 22:26403136-26403158 CTGAGGATGTGGGTGGACTCTGG - Intergenic
1182145336 22:27993768-27993790 GTGTGGAAGGGGTTGGTTTAGGG - Intronic
1183553999 22:38510829-38510851 CTGTGGAGCTGGTTGACTTCTGG + Intergenic
1183739401 22:39661780-39661802 CTGTGGATGTGGATGGAGTGAGG + Intronic
1183756502 22:39771347-39771369 CTGTAGAGCTGGCTGGATTCAGG - Intronic
1185354981 22:50362889-50362911 CTGTTGAAGGTGTTGTATTCTGG + Intronic
949840441 3:8314223-8314245 CTGTGGAACTGATTGGATGCTGG - Intergenic
949862102 3:8515352-8515374 CTGAGGAAGGGGTGGGATTTGGG - Intronic
951449825 3:22824920-22824942 CCATGGAAGTGGTTGGATTCTGG - Intergenic
953876761 3:46671103-46671125 CTGTGCATGTGGTTGGGATCAGG - Intronic
953917249 3:46927897-46927919 CTTTGGTAGTGGTGGAATTCCGG - Intronic
954136335 3:48583824-48583846 CTGGGGCAGTGGTTGGGTGCTGG - Intronic
954566441 3:51604057-51604079 TGGTGAAAGTAGTTGGATTCAGG + Intronic
955764800 3:62331356-62331378 CCGTGGAAGTGGGTGAATCCTGG - Exonic
955870142 3:63429700-63429722 CTGAGGATGTCGTTGCATTCTGG - Intronic
956726951 3:72164010-72164032 CTGTGGTGGTGGTTGGAGTGGGG - Intergenic
958465547 3:94453393-94453415 TTGTGGAAGGGGATGGTTTCAGG + Intergenic
959567740 3:107849630-107849652 GTGTGGATGTGGTAGGAGTCGGG - Intergenic
962732041 3:138292478-138292500 ATTGAGAAGTGGTTGGATTCAGG + Intronic
964885054 3:161472479-161472501 CATTGGAAGTGGTTGGCTTGTGG + Intergenic
967028204 3:185582694-185582716 CTGTGGCAGTGGTGGGGTTGGGG + Intronic
967212774 3:187183426-187183448 CTGAGGAAGTGGGTGGATTATGG + Intergenic
968393121 4:209320-209342 GTGTGGAACTGGTTTGAATCAGG + Intergenic
968402408 4:309457-309479 GTGTGGAACTGGTTTGAATCAGG - Intergenic
968421092 4:485411-485433 GTGTGGAACTGGTTTGAATCAGG + Intronic
968424993 4:517300-517322 GTGAAGAAGTGGTTGCATTCTGG + Intronic
971537804 4:27775951-27775973 TTGGGGTAGTGGTTGGAGTCTGG + Intergenic
974085438 4:57255713-57255735 CTGGGCAAGTGTTTAGATTCTGG - Intergenic
975410511 4:74043390-74043412 CTGTGGAGGTGGACTGATTCAGG - Intergenic
979320361 4:119316084-119316106 GATGGGAAGTGGTTGGATTCTGG + Intergenic
979860210 4:125683678-125683700 CTGTGGACTTTGCTGGATTCTGG + Intergenic
979983130 4:127281315-127281337 GTGTGGAGGTGGTAAGATTCAGG - Intergenic
981542389 4:145859470-145859492 CTGTGGGAGTCGTTGGACTGTGG + Intronic
981634782 4:146864237-146864259 CTGTGGAACTGGGTGGATGCTGG - Intronic
982883949 4:160754939-160754961 CTGCAGTAATGGTTGGATTCTGG - Intergenic
983061963 4:163170877-163170899 CTGTGGAAGTAGGTAAATTCAGG - Intergenic
984937678 4:184903561-184903583 ATTTGGAAGTGGCTGGATTTAGG + Intergenic
985384610 4:189432342-189432364 CTGTGGAGAGGGTTGGATTAGGG + Intergenic
986587649 5:9335440-9335462 CTCTGCAAGTGGTTGGCTTTTGG - Intronic
991002008 5:61792276-61792298 CTGTGGAAGGGAATGGATTCAGG - Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
992905831 5:81344891-81344913 CTTTGAAATGGGTTGGATTCTGG + Exonic
995372394 5:111433608-111433630 ATGGGGAAGTGGTAAGATTCTGG + Intronic
999892578 5:155994852-155994874 CTGAGCATGTGGCTGGATTCAGG + Intronic
1001319971 5:170672450-170672472 CTTTGGAAGCGTTTGGATTCTGG - Intronic
1001373778 5:171234582-171234604 CAGTGGGAGTGGTCAGATTCTGG + Intronic
1001539561 5:172527848-172527870 GAGGGGAAGTGGTTGGATCCAGG + Intergenic
1002307548 5:178292684-178292706 TGGTGGACGTGGTTGGGTTCTGG + Intronic
1003214854 6:4099783-4099805 ATGTGGAATTGGTTGGATTCCGG + Intronic
1004193590 6:13485981-13486003 CGGTGGGAGTGGTTGGATGGGGG - Intronic
1005302941 6:24488932-24488954 CTGTAAAAGTGCTTGGCTTCAGG - Intronic
1005955724 6:30662129-30662151 CTGTCAGAGTGGTTGGACTCTGG - Intronic
1006382768 6:33710147-33710169 AGATGGAAGTGGTTGGATTCAGG - Intronic
1007683217 6:43648759-43648781 CTGTGGAAGTGGTTGGATTCTGG + Intronic
1008590188 6:52986551-52986573 ATGTGGAAAGTGTTGGATTCAGG - Intronic
1009460950 6:63912651-63912673 TGGTGGAGGTGGTTGGATTATGG + Intronic
1009884940 6:69614868-69614890 CTGGGGAAATGGTTTGTTTCAGG + Intergenic
1010480168 6:76342066-76342088 TTGTGGAAGTGGCTGAATTGAGG - Intergenic
1013443202 6:110192279-110192301 CTTCAGAAGTGGTTGAATTCTGG + Intronic
1015111394 6:129595954-129595976 GTGGAGAAATGGTTGGATTCTGG - Intronic
1017577225 6:155818408-155818430 CTGTTGAGGTGGTGGGATACTGG + Intergenic
1017859151 6:158379115-158379137 ATGTGAAACTGGCTGGATTCGGG + Intronic
1018071351 6:160167180-160167202 CTGGAGAAGTGGGTGGCTTCAGG + Intergenic
1020227513 7:6291752-6291774 CTGTGAAAGTGCTGGGATTATGG + Intergenic
1022356030 7:29615385-29615407 TGGTGAAAGTGGTTGCATTCAGG - Intergenic
1022461806 7:30616048-30616070 CTGTTGAACAGGTAGGATTCTGG + Exonic
1029121098 7:98268853-98268875 CTGCCAAAGTGGTGGGATTCAGG - Intronic
1029790326 7:102836822-102836844 CTGTCAAAGTGGTTTAATTCAGG - Intronic
1030136378 7:106254735-106254757 CTGTGGTTCTGGTAGGATTCGGG + Intronic
1031427874 7:121629682-121629704 ATAGGAAAGTGGTTGGATTCTGG + Intergenic
1032269369 7:130389523-130389545 CTGGGGAAGTGAGTGGATTGGGG + Intergenic
1033447571 7:141436324-141436346 GTGTGGATGTGGTTTGCTTCAGG + Intronic
1033457722 7:141517687-141517709 CTGAGGAAGTGGCTGGATGAGGG + Intergenic
1034896316 7:154878589-154878611 CTGTGGGAGTGGGAGGAGTCAGG - Intronic
1036029996 8:4959507-4959529 AGCTGGAAGTTGTTGGATTCTGG - Intronic
1037698874 8:21253742-21253764 CTGTTGAAGGTGTTGGGTTCTGG - Intergenic
1037746799 8:21651923-21651945 CAGTGGAAGTGGTCAGATTCTGG - Intergenic
1038066930 8:23973022-23973044 GTGGGGGAGTGGGTGGATTCAGG + Intergenic
1038794774 8:30700208-30700230 CTGTGAAAGTGTTTGGTTTTTGG - Intronic
1038971221 8:32637758-32637780 CAGGGGAAGTTGTTGGGTTCTGG + Intronic
1044928547 8:97230219-97230241 CTGTGGGAGAGGTTTGTTTCAGG + Intergenic
1046352311 8:113031857-113031879 TGGTGGAAGTGATTGGATTATGG + Intronic
1046607162 8:116384125-116384147 CAGTGGAAGCTGTTGGTTTCAGG - Intergenic
1046854804 8:119019055-119019077 CTCTGGGAGTTGTTGGATGCGGG - Intronic
1047464395 8:125098607-125098629 TGGTGAGAGTGGTTGGATTCTGG + Intronic
1051336248 9:16069034-16069056 CTATTGAAGTGGCTGCATTCAGG + Intergenic
1051657494 9:19396974-19396996 CTTTGTATGTGGTTGGATCCTGG + Intergenic
1053265932 9:36713607-36713629 CTGTGGCAGAGGATGAATTCTGG - Intergenic
1054973322 9:71114608-71114630 CGGTGGAGGTGGTTGGGTTGGGG + Intronic
1055080483 9:72263927-72263949 GGAAGGAAGTGGTTGGATTCTGG + Intergenic
1055648973 9:78388536-78388558 CAGTGGGAGTGATTGGATCCTGG + Intergenic
1057340245 9:94194454-94194476 CTCTGAAAGTGGTGGGATTACGG + Intergenic
1057572948 9:96218192-96218214 GCGTGGAAGAGGTTGGACTCAGG - Intergenic
1057987199 9:99729491-99729513 GTTGAGAAGTGGTTGGATTCTGG - Intergenic
1058934393 9:109754916-109754938 CTGTGCAACTGGTTGGATAGTGG - Intronic
1060409302 9:123389519-123389541 CTGTGGAAGTGGCAGGAGCCAGG - Intronic
1060783928 9:126434138-126434160 GTGTGACAGTAGTTGGATTCAGG - Intronic
1061376680 9:130229988-130230010 CTGTGGAACTGGTTAAATTATGG - Intronic
1062323308 9:136001062-136001084 CTGGGGAAGTGATGGGTTTCAGG + Intergenic
1187097632 X:16164365-16164387 TTGGGGAATGGGTTGGATTCAGG - Intergenic
1192791465 X:74386090-74386112 CTGTGTAATAGGTTGGATTTAGG - Intergenic
1193088387 X:77468078-77468100 CTGTGAAACTCGCTGGATTCAGG + Intergenic
1194436289 X:93872182-93872204 CTGGGAAAGTGGCTGGGTTCAGG + Intergenic
1196188200 X:112766970-112766992 CAGTGGAAGTGGTCAGATTCTGG + Intergenic
1196465977 X:115972010-115972032 CTATGGATGTGGTTAGATTCAGG - Intergenic
1197585997 X:128349142-128349164 CTGCAAAAGTGTTTGGATTCTGG + Intergenic
1198506791 X:137309116-137309138 CTGTAGAAGTGGCTGGCTGCAGG + Intergenic
1199802646 X:151266913-151266935 AAGTGGAAGTTGTTGGATTAGGG - Intergenic
1201306834 Y:12557714-12557736 TTGTGAAAGTGGTTGAGTTCTGG + Intergenic
1201624173 Y:15995812-15995834 ATGTGGAAGTGATTGGATCATGG - Intergenic