ID: 1007685819

View in Genome Browser
Species Human (GRCh38)
Location 6:43666773-43666795
Sequence CTCAAATATATGTATATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1606
Summary {0: 1, 1: 3, 2: 20, 3: 200, 4: 1382}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007685819_1007685820 -8 Left 1007685819 6:43666773-43666795 CCATATATATACATATATTTGAG 0: 1
1: 3
2: 20
3: 200
4: 1382
Right 1007685820 6:43666788-43666810 TATTTGAGACAGAGTCTCGCTGG 0: 2
1: 30
2: 135
3: 336
4: 688
1007685819_1007685823 25 Left 1007685819 6:43666773-43666795 CCATATATATACATATATTTGAG 0: 1
1: 3
2: 20
3: 200
4: 1382
Right 1007685823 6:43666821-43666843 CATTACAACCTCTGCCTCCTGGG 0: 36
1: 2405
2: 37175
3: 113269
4: 172249
1007685819_1007685822 24 Left 1007685819 6:43666773-43666795 CCATATATATACATATATTTGAG 0: 1
1: 3
2: 20
3: 200
4: 1382
Right 1007685822 6:43666820-43666842 TCATTACAACCTCTGCCTCCTGG 0: 70
1: 4089
2: 58912
3: 110076
4: 144034

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007685819 Original CRISPR CTCAAATATATGTATATATA TGG (reversed) Intronic
900753606 1:4417401-4417423 CAAAAATATGTGTATGTATATGG + Intergenic
901100933 1:6718112-6718134 TTAAAAAATATATATATATATGG + Intergenic
901281141 1:8036082-8036104 TACATATATATATATATATATGG - Intergenic
902071655 1:13744638-13744660 CCAATATATATATATATATAAGG + Intronic
902434382 1:16388404-16388426 TTAAAATATATTTATATATTTGG - Intronic
903807166 1:26013625-26013647 CATATATATATATATATATATGG - Intergenic
903843716 1:26263764-26263786 GTCAACTATATATATATATCAGG - Intronic
903938894 1:26915066-26915088 TATATATATATGTATATATATGG + Intronic
904104129 1:28063289-28063311 AAAAAATATATATATATATAAGG - Intronic
904156113 1:28484608-28484630 ATCAAATCCATATATATATATGG - Intronic
904470553 1:30733335-30733357 ATTACATATATTTATATATAGGG + Exonic
904741530 1:32680256-32680278 CAAAAATATATGAATATATGGGG - Exonic
905784830 1:40746408-40746430 CTCAAATATATGTCAAAAAAAGG - Intronic
906043682 1:42810446-42810468 CAAATATATATGTATATATGTGG - Intronic
906277668 1:44529259-44529281 TTCAAATATATGTTTTTAAATGG - Intronic
906428420 1:45734098-45734120 TACAAATATATATATAAATAAGG + Intronic
906878362 1:49562606-49562628 ATCAGATATTTGTAGATATATGG + Intronic
907066474 1:51489285-51489307 CATATATATATATATATATATGG - Intronic
907150736 1:52284901-52284923 AACATATATATGTATATCTAAGG + Intronic
907323992 1:53624782-53624804 GAGATATATATGTATATATATGG - Intronic
907378583 1:54065712-54065734 CAAAAATATATATATATATAAGG + Intronic
907596885 1:55728217-55728239 TTCATATATATATATATACATGG - Intergenic
908026303 1:59955306-59955328 CATATATATATGGATATATATGG - Intergenic
908190890 1:61702748-61702770 GTTACATATATATATATATAAGG - Intronic
908341294 1:63182410-63182432 CCCATATATATGTACATATGTGG + Intergenic
908936169 1:69378730-69378752 ATTATATATATATATATATATGG + Intergenic
909038653 1:70624067-70624089 GACATATATATATATATATATGG - Intergenic
909135430 1:71793262-71793284 TACAAATATATATATATATATGG - Intronic
909210891 1:72821802-72821824 CAAATATATATATATATATATGG - Intergenic
909212253 1:72838797-72838819 CACATATATATGTATATTTATGG - Intergenic
909243317 1:73242850-73242872 CTCAAAACTATGCAAATATATGG + Intergenic
909252183 1:73372263-73372285 CACATATATATACATATATATGG + Intergenic
909252184 1:73372298-73372320 CACATATATATACATATATATGG + Intergenic
909252185 1:73372333-73372355 CACATATATATACATATATATGG + Intergenic
909323050 1:74314080-74314102 TGTATATATATGTATATATATGG + Intronic
909349080 1:74627662-74627684 CATACATATGTGTATATATACGG + Intronic
909359900 1:74747808-74747830 TACACACATATGTATATATATGG + Intronic
909659950 1:78070522-78070544 ATGATATATATATATATATATGG + Intronic
909803944 1:79851228-79851250 GTCACATATATGGATATATATGG - Intergenic
909947681 1:81682085-81682107 CACATATATATGTATATATATGG - Intronic
910116544 1:83737836-83737858 TTCATATACATGTACATATATGG + Intergenic
910438916 1:87232409-87232431 CACATATATATGTATATATATGG + Intergenic
910723163 1:90309982-90310004 CACACATATCTGTATATATACGG + Intergenic
910731357 1:90400635-90400657 CACATATATGTGTATATGTATGG - Intergenic
910882875 1:91938394-91938416 CCCATATATATATATATATGGGG - Intergenic
910882878 1:91938395-91938417 CCCATATATATATATATATGGGG + Intergenic
910894729 1:92056931-92056953 GTCAAATTTCTGTATATATGAGG - Intronic
911298364 1:96145021-96145043 CACAGATATATATATATATATGG + Intergenic
911435454 1:97851248-97851270 GACATATATATATATATATATGG - Intronic
911456640 1:98132638-98132660 CTAAAATAGAAGTATAGATAGGG - Intergenic
911461059 1:98191757-98191779 CTGATATATATATATATAAAGGG - Intergenic
911602779 1:99865162-99865184 TCAAAATATATATATATATAGGG + Intronic
911692951 1:100856099-100856121 CTCAAATTTATTTTTGTATATGG + Intergenic
911760847 1:101614232-101614254 CTTAAATTGATGTATATATTTGG - Intergenic
912089860 1:106057985-106058007 TTTAAATATATGAATATATGGGG - Intergenic
912175814 1:107154746-107154768 CTGATATATATATATATATCAGG - Intronic
912175815 1:107154747-107154769 CTGATATATATATATATATCAGG + Intronic
912240737 1:107905359-107905381 AACAAATACATGTAAATATATGG - Intronic
912251680 1:108018663-108018685 CACATATATATATGTATATATGG + Intergenic
912304341 1:108550609-108550631 TTTAAATATATAAATATATATGG + Intergenic
912394094 1:109326584-109326606 CACACACATATATATATATATGG + Intronic
913351740 1:117868837-117868859 TTAACATAGATGTATATATAAGG + Exonic
913499216 1:119455222-119455244 CCCAAACATATATATATATAGGG + Intergenic
913712026 1:121494691-121494713 CTCAAATGAATGTATCTATAGGG - Intergenic
914444208 1:147736001-147736023 CATATATATATATATATATATGG - Intergenic
914824249 1:151130079-151130101 TTTAAATATATATATTTATACGG + Intergenic
914873264 1:151492996-151493018 CAAAAATATATATATATATTGGG + Intergenic
914891664 1:151629885-151629907 CAAAAAAATATATATATATATGG - Intronic
915182378 1:154073511-154073533 CTCAAATAAATAAATAAATAAGG + Intronic
915693786 1:157717399-157717421 CTGAAGTTTATGCATATATATGG + Intergenic
915834693 1:159167069-159167091 CTAAGTCATATGTATATATAGGG + Intergenic
915999709 1:160603499-160603521 CTCAAAACTATGCAAATATATGG - Intergenic
916279825 1:163037567-163037589 TACACATATATGTGTATATATGG + Intergenic
916339575 1:163715595-163715617 CACATATATATGTGTATATATGG + Intergenic
916622486 1:166515328-166515350 ATCAAAGTTATATATATATAAGG + Intergenic
916841092 1:168601702-168601724 AAAAAATATATATATATATAAGG + Intergenic
917185546 1:172350740-172350762 CTCATCTATCTGTATATACATGG + Intronic
917190354 1:172411091-172411113 TATAAATATATGTATATGTATGG + Exonic
917432933 1:174989520-174989542 CACAAATAAATGTAAACATATGG - Intronic
917662046 1:177186457-177186479 ATAAACCATATGTATATATATGG - Intronic
917684173 1:177399423-177399445 ATATAATATATATATATATATGG + Intergenic
917736982 1:177930352-177930374 CTCAGAGATATGTATATGAAGGG - Intronic
917825956 1:178820595-178820617 CTAGAATAAAAGTATATATAGGG - Intronic
917947526 1:179990640-179990662 ATTTAATATATGTATATATTTGG - Intronic
918359884 1:183746373-183746395 CACATATATATTTATATGTATGG + Intronic
918489292 1:185063392-185063414 CTCAAATCTGGCTATATATAAGG - Intronic
918683598 1:187387221-187387243 ATAAAATATATGTATATTTTTGG - Intergenic
918768188 1:188516314-188516336 CTCAAATATCTGAAAATAAAAGG - Intergenic
918811606 1:189128844-189128866 TTTATATATATTTATATATAGGG - Intergenic
918818035 1:189215847-189215869 TTAAAATGTATATATATATATGG - Intergenic
919086668 1:192928884-192928906 CCCAAATATATGTATTCACATGG - Intergenic
919256577 1:195132790-195132812 CATATATATGTGTATATATATGG - Intergenic
919260328 1:195184637-195184659 TAAATATATATGTATATATATGG + Intergenic
919456235 1:197822990-197823012 AAGACATATATGTATATATATGG - Intergenic
919485228 1:198137874-198137896 CTCATGTATATATATATATGGGG - Intergenic
919553255 1:199019365-199019387 CACATATATGTGTATATATATGG + Intergenic
919672356 1:200349426-200349448 CATATATACATGTATATATATGG + Intergenic
920019895 1:202947518-202947540 AAAAAATATATATATATATATGG + Intronic
920909343 1:210200258-210200280 CTCAAATATATTTAGACACAAGG + Intergenic
921026745 1:211291239-211291261 ATCACAGGTATGTATATATAGGG + Intronic
921444599 1:215230558-215230580 CTTGTATATATATATATATATGG - Intronic
921527101 1:216231232-216231254 ATATAATATATATATATATATGG - Intronic
921528465 1:216248535-216248557 ATAATATATATGTATATATATGG + Intronic
921596888 1:217064055-217064077 TACAAATATATATGTATATAGGG - Intronic
921680507 1:218025619-218025641 CACAAATGTATGTACATATGTGG + Intergenic
921895793 1:220399221-220399243 CTTGAATAAATGTTTATATATGG + Intergenic
922392794 1:225163527-225163549 CTCAAATAACTGTGTATAGAAGG - Intronic
922742893 1:228025155-228025177 TTCAAATATATGTAAATTTTAGG + Intronic
922885286 1:229015478-229015500 TATATATATATGTATATATATGG - Intergenic
923074182 1:230594656-230594678 CTCAAATATATGTAAATCTTAGG + Intergenic
923398796 1:233595392-233595414 CTCAAATCTATTTTTGTATATGG + Intergenic
923605671 1:235440388-235440410 CAAAAAAATATATATATATACGG - Intronic
923669543 1:236028687-236028709 CATATATATATATATATATATGG + Intronic
923695868 1:236250631-236250653 TGCAAACATATATATATATATGG + Intronic
923958164 1:239045766-239045788 CTCAAATAAATAAATAAATAAGG + Intergenic
924210414 1:241760329-241760351 TATAAATATATATATATATATGG - Intronic
924879907 1:248149606-248149628 CTCAAAAACATGCAAATATATGG - Intergenic
1062950526 10:1498001-1498023 ATCAAATATTTGTGTGTATATGG + Intronic
1063027139 10:2191520-2191542 ATGAAAAATATATATATATAAGG - Intergenic
1063412071 10:5843985-5844007 CATATATATATATATATATATGG - Intergenic
1063553453 10:7055358-7055380 ATCAAATATCTGTCTAAATATGG + Intergenic
1063836427 10:10019750-10019772 CTCAATTATTTGTATCTTTAAGG + Intergenic
1064227706 10:13502036-13502058 GATCAATATATGTATATATAAGG + Intronic
1064256258 10:13744931-13744953 TAAAAATCTATGTATATATAGGG + Intronic
1064282335 10:13962396-13962418 CAAAAAGATATGCATATATATGG + Intronic
1064549819 10:16488582-16488604 TTTAAATATATATATATATATGG + Intronic
1064971918 10:21074776-21074798 CAAAAATATATATATCTATATGG - Intronic
1064988359 10:21233816-21233838 TACATATATATGCATATATATGG + Intergenic
1064988360 10:21233895-21233917 TACATATATATGCATATATATGG + Intergenic
1065135481 10:22664021-22664043 TATATATATATGTATATATATGG - Intronic
1065326976 10:24557956-24557978 TATATATATATGTATATATATGG - Intergenic
1065400850 10:25299431-25299453 ATCAAATATGTATAAATATAGGG - Intronic
1065608180 10:27443360-27443382 CACACATATATGTGTATATCTGG + Intergenic
1065984335 10:30934480-30934502 TTCAAATATATGTATACAAGAGG - Intronic
1066244878 10:33572699-33572721 TACATATATATATATATATAGGG - Intergenic
1066280007 10:33907179-33907201 ACCATATATATATATATATATGG + Intergenic
1066280008 10:33907180-33907202 ACCATATATATATATATATATGG - Intergenic
1066532643 10:36357092-36357114 CACATATATATATATATATTAGG + Intergenic
1067156702 10:43787677-43787699 CATATATATATATATATATATGG - Intergenic
1067162280 10:43837073-43837095 CTCATATACACATATATATATGG - Intergenic
1067654634 10:48181858-48181880 CATATATATATATATATATATGG + Intronic
1067867126 10:49920639-49920661 TACACATATACGTATATATATGG + Intronic
1067907810 10:50311878-50311900 GTCAAATATATGAATATTTTTGG + Intronic
1067921430 10:50462286-50462308 GTAAAATATATTTATATAAAAGG + Intronic
1068019153 10:51559104-51559126 CACAGATATACATATATATATGG + Intronic
1068062733 10:52089673-52089695 TTCAGATATATTTATATACATGG + Intronic
1068326956 10:55503411-55503433 TTAAAATATATTTAAATATATGG + Intronic
1068328023 10:55520034-55520056 TATATATATATGTATATATATGG - Intronic
1068780245 10:60912230-60912252 CACACATATATATATGTATATGG + Intronic
1068826818 10:61449682-61449704 CTAAAATATATACATATATAAGG - Intronic
1069143132 10:64853520-64853542 CACATATACATGTATATATCAGG - Intergenic
1069184605 10:65407758-65407780 CATACATATATATATATATATGG - Intergenic
1069257592 10:66353357-66353379 CTCAAATATATATTTTTAAAAGG + Intronic
1069363924 10:67676396-67676418 GTAAAATATATGTGTATATGTGG + Intronic
1069371172 10:67749122-67749144 CATAAATATATGCATAAATAGGG - Intergenic
1070113429 10:73506531-73506553 CTAATATATATATATATATCTGG + Intronic
1070365679 10:75734526-75734548 CTTAATTATATCAATATATAAGG + Intronic
1070452085 10:76569700-76569722 GTCAAGTTTATGTATATATGTGG + Intergenic
1070460663 10:76666453-76666475 CAAATATATATGTATATATGTGG + Intergenic
1070864302 10:79697163-79697185 CACGTATATATGTACATATATGG - Intergenic
1071407646 10:85354342-85354364 CACACATATATCTCTATATATGG + Intergenic
1071534586 10:86417368-86417390 CTCAAAAATAAGTAAATACATGG - Intergenic
1071548567 10:86547972-86547994 AATAAATATATATATATATATGG - Intergenic
1071631201 10:87219390-87219412 CACGTATATATGTACATATATGG - Intergenic
1071892486 10:90026368-90026390 CACATATATACATATATATACGG + Intergenic
1072063786 10:91844794-91844816 CATATATATATGTATTTATAAGG - Intronic
1072179068 10:92962376-92962398 GTTAAAAATATATATATATATGG + Intronic
1072772706 10:98154927-98154949 CACATACATACGTATATATACGG - Intronic
1073611072 10:104943897-104943919 CTCAAGCAACTGTATATATATGG - Intronic
1073736074 10:106348320-106348342 CTAAAAGATATGTATATAATAGG - Intergenic
1073742806 10:106428637-106428659 CATAAATTTATGTATATACATGG + Intergenic
1073992745 10:109281886-109281908 CATATATATATGTATATATATGG - Intergenic
1074035081 10:109730638-109730660 CTCATAGATGTGTATATATCTGG - Intergenic
1074136766 10:110634180-110634202 ATACAATAAATGTATATATAAGG + Intergenic
1074172445 10:110956034-110956056 CCCAAATATATGGCTATGTATGG + Intronic
1074261594 10:111859116-111859138 TTTAGATATATGTATATACATGG - Intergenic
1074604970 10:114953585-114953607 CATAAATGTATGTATCTATATGG - Intronic
1074759666 10:116657606-116657628 CACAAATATATATAGACATATGG - Intergenic
1074918420 10:117982051-117982073 TACATATATGTGTATATATATGG + Intergenic
1074921049 10:118012525-118012547 CAGAAATATATATATATATGTGG - Intronic
1075206736 10:120455672-120455694 TACATATATATATATATATATGG - Intergenic
1075298428 10:121298608-121298630 CTCAAATTTATGTATTTCTAGGG + Intergenic
1078027417 11:7710426-7710448 ATCAGATAGATGTAGATATATGG + Intergenic
1078054182 11:7993827-7993849 ATCCAGTATATATATATATATGG + Intronic
1078071181 11:8112253-8112275 AGAAAATATATGTGTATATACGG - Intronic
1078078958 11:8189899-8189921 TATATATATATGTATATATATGG - Intergenic
1078078960 11:8189949-8189971 CACAAATATATATATATTTGGGG - Intergenic
1078745534 11:14110446-14110468 ATAAGATATATGTATATAAAAGG + Intronic
1079047849 11:17124034-17124056 ATCATATATATATATATATGGGG + Intronic
1079292143 11:19197820-19197842 AACATATATATATATATATATGG + Intronic
1079361621 11:19775180-19775202 TTAAAATATATTTATATATTTGG - Intronic
1079436301 11:20455174-20455196 CTAAAATAAATGTATATTTTAGG + Intronic
1079774664 11:24509877-24509899 CTCAAGTAAAAGAATATATAGGG - Intronic
1079860594 11:25665766-25665788 ATCAAATATATGTAAAGATAGGG - Intergenic
1079874332 11:25837774-25837796 CATATATATGTGTATATATAGGG - Intergenic
1080154926 11:29098547-29098569 CTAAAATATATCTATATTTGGGG - Intergenic
1080182323 11:29440243-29440265 CACACATATATATATATATTTGG + Intergenic
1080337489 11:31214819-31214841 TTCAAATATATGTTAATTTAGGG + Intronic
1080502218 11:32881791-32881813 CTCAAGAATTTGTATATATTTGG + Intergenic
1080509116 11:32949633-32949655 CACAAAAATATGTATGTAAATGG - Intronic
1080547327 11:33333569-33333591 GGCAAATATATTTATATATTAGG + Intronic
1080853577 11:36092313-36092335 TTTAAATTTATGCATATATATGG + Intronic
1080987770 11:37491255-37491277 CACACATATATATATATATCAGG - Intergenic
1080987771 11:37491281-37491303 CACATATATATATATATATCAGG - Intergenic
1080993106 11:37565385-37565407 TTAAAATATACATATATATAAGG + Intergenic
1081151762 11:39641213-39641235 CCAAAAAATATATATATATATGG + Intergenic
1081240215 11:40696279-40696301 CACATATATATATATATATATGG + Intronic
1081240221 11:40696404-40696426 CTCCAGCATATATATATATATGG - Intronic
1081341303 11:41931138-41931160 CCCACATACATGTATATATGTGG + Intergenic
1081415873 11:42815081-42815103 TACATATATATATATATATATGG + Intergenic
1081510215 11:43763583-43763605 CCCTTATATATATATATATAAGG + Intronic
1081714678 11:45241278-45241300 CAAATATATATGAATATATATGG + Exonic
1081897208 11:46596837-46596859 CAAATATGTATGTATATATATGG + Intergenic
1082188779 11:49216483-49216505 CAAAGATATATATATATATATGG + Intergenic
1082210073 11:49489045-49489067 CACATATGTATGTGTATATAAGG - Intergenic
1082618268 11:55389278-55389300 CTCACATATATGAAAATACAGGG - Intergenic
1082649245 11:55767961-55767983 CTGATATATATATATATATATGG + Intergenic
1082678124 11:56134409-56134431 TACATATATATATATATATATGG + Intergenic
1083205997 11:61149680-61149702 CTCAAACATAAGCATACATAGGG + Intronic
1083285067 11:61653306-61653328 TTTATATATATATATATATATGG + Intergenic
1083696439 11:64446035-64446057 CACACATATATATATATGTATGG - Intergenic
1084723630 11:70925953-70925975 GTCAACAATATGTATAAATAAGG - Intronic
1084836568 11:71806343-71806365 CACACACATATGTATGTATATGG - Intergenic
1084881722 11:72176578-72176600 CTCAAATAAATAAATAAATAAGG + Intergenic
1085371320 11:76008618-76008640 TTCAAGTATATGTAAATGTAGGG + Intronic
1085540990 11:77269446-77269468 CTAAAACATCTGTATATTTAAGG + Intronic
1085812426 11:79696194-79696216 CATATATATATATATATATATGG - Intergenic
1085998016 11:81945483-81945505 GACATATATATATATATATATGG - Intergenic
1086039738 11:82461309-82461331 AAAAAATATATATATATATATGG + Intergenic
1086625115 11:88941359-88941381 CTCATTATTATGTATATATATGG - Intronic
1086636900 11:89099738-89099760 CTCAAACTTGTGCATATATAAGG + Intergenic
1086639596 11:89136485-89136507 CACATATATATGTGTATATAAGG + Intergenic
1086745682 11:90424201-90424223 CAGAAATAAATATATATATATGG + Intergenic
1086777086 11:90850696-90850718 CACATATATATGTATGTATCTGG + Intergenic
1087318757 11:96635209-96635231 CTTATATATATGTATATATAAGG - Intergenic
1087318758 11:96635210-96635232 CTTATATATACATATATATAAGG + Intergenic
1087318760 11:96635245-96635267 CACATATATATATATATGTAAGG + Intergenic
1087390812 11:97531192-97531214 GTGAAACATATATATATATAGGG + Intergenic
1087526423 11:99319718-99319740 ATCAAATAAATGTCTAGATATGG - Intronic
1087570018 11:99914527-99914549 TTCAAATATATGTACCTACAAGG - Intronic
1087690312 11:101313648-101313670 CTCAAAAACATGAATATAGAAGG - Intergenic
1087852694 11:103050878-103050900 CTCTAATAAAAGTATATACAAGG + Intergenic
1088040035 11:105369564-105369586 CACAATTATATGTCTAAATAAGG - Intergenic
1088181422 11:107117027-107117049 TTAAAATATAGGTATACATAAGG - Intergenic
1088690575 11:112323111-112323133 ATCATAGATATGTATGTATAGGG - Intergenic
1088778483 11:113110078-113110100 TTTTAATATATGTATATATTTGG + Intronic
1088996564 11:115004857-115004879 TATAAATATATATATATATATGG - Intergenic
1089903985 11:122018220-122018242 CTCTGATATATATATATATCGGG + Intergenic
1090121743 11:124037074-124037096 TTTAAATATATGTATTTATTTGG + Intergenic
1090498568 11:127239268-127239290 CTACCATATATATATATATATGG + Intergenic
1090509693 11:127361872-127361894 ATCAAATATATTTAAATCTATGG - Intergenic
1091861076 12:3784284-3784306 TACATATATATGTATATACATGG + Intergenic
1091946278 12:4547066-4547088 CTCAAATAAATAAATAAATAAGG - Intronic
1092402668 12:8189762-8189784 CACACACATATGTATGTATATGG + Intergenic
1092641986 12:10522525-10522547 CTCAAATCTATTTAGGTATAAGG - Intronic
1092668423 12:10833300-10833322 CACAGATATAGGTACATATATGG + Intronic
1093128963 12:15366627-15366649 CTCAAAAATAAGTATTAATATGG - Intronic
1093192307 12:16089048-16089070 CCTAAATATATGCATATATGTGG + Intergenic
1093225640 12:16479937-16479959 CACAATTATATGTAAATATCAGG + Intronic
1093290360 12:17312416-17312438 CTCAAGTCTATGTACATATTTGG - Intergenic
1093355642 12:18163615-18163637 CACACACATATATATATATATGG + Intronic
1093476225 12:19557644-19557666 CTCAAATAACTGGATATAGAAGG - Intronic
1093551590 12:20419044-20419066 TTCAGATATATGTCTGTATATGG + Intronic
1093621130 12:21290637-21290659 CTCAAATCTATTTTTATATGTGG - Intronic
1093733898 12:22596699-22596721 AACAGATATATGTATATATATGG + Intergenic
1093981223 12:25477769-25477791 TGCATATATATGTATATATATGG - Intronic
1094147544 12:27245534-27245556 CTCAATCATATATGTATATAAGG + Intronic
1094522993 12:31212681-31212703 CACATATATGTGTATATATATGG + Intergenic
1094621280 12:32082871-32082893 CTCAAAAATATATATATATTTGG - Intergenic
1094681802 12:32673872-32673894 TATATATATATGTATATATATGG + Intergenic
1094779967 12:33779460-33779482 CTAATATATATGTATATTTAAGG + Intergenic
1095471905 12:42545894-42545916 CTTCCATATATATATATATATGG - Intronic
1095536325 12:43252583-43252605 CTGGCATATATATATATATATGG + Intergenic
1095686268 12:45038537-45038559 AATATATATATGTATATATAAGG - Intronic
1095729167 12:45487410-45487432 CATACATATATATATATATATGG + Intergenic
1095774463 12:45997163-45997185 CTCAAAAAAATATATATATATGG - Intergenic
1095807820 12:46339912-46339934 TTCCATTATATATATATATATGG + Intergenic
1095818815 12:46454456-46454478 TTCAGATATATATATATATATGG + Intergenic
1095932714 12:47644610-47644632 TTCAAATATAATTATATAAAAGG + Intergenic
1096068169 12:48757689-48757711 AATATATATATGTATATATATGG + Intergenic
1096131841 12:49165532-49165554 CACACATATATGTATATGTGTGG - Intergenic
1096253159 12:50046308-50046330 CTCAAATACATGCATAAATAAGG + Intergenic
1096667353 12:53174789-53174811 TTCAAAAATATATATATATATGG + Intronic
1096883686 12:54695374-54695396 TACATATATATGTATATATGTGG - Intergenic
1096883688 12:54695406-54695428 TACATATATATGTATATATGTGG - Intergenic
1096883697 12:54695517-54695539 CATATATATATGCATATATATGG + Intergenic
1096935044 12:55264295-55264317 ATCAAATATATATATATGAATGG + Intergenic
1097372461 12:58800895-58800917 CACATATATGTATATATATATGG - Intronic
1097375975 12:58843131-58843153 CTTAAATATATATATATTTAAGG - Intergenic
1097676816 12:62611802-62611824 CTAAAATATATATATATATAAGG + Intergenic
1097813906 12:64050454-64050476 TTTAAAAATGTGTATATATAGGG - Intronic
1097836444 12:64277630-64277652 ATTATATATATATATATATAGGG - Intronic
1097842986 12:64339961-64339983 CTTCCATATATTTATATATATGG + Intronic
1097855600 12:64458512-64458534 CATATATATATATATATATATGG + Intronic
1098003803 12:65973364-65973386 TACATATATATGCATATATATGG - Intergenic
1098337481 12:69419013-69419035 CATATATATATATATATATATGG - Intergenic
1098443502 12:70542585-70542607 AAAAAATATATATATATATATGG + Intronic
1098650813 12:72965474-72965496 CATAAATATATATATATATATGG + Intergenic
1098875855 12:75865861-75865883 AACAAATATATATTTATATATGG - Intergenic
1098924918 12:76338685-76338707 CACACATATATATATATAAAGGG + Intergenic
1098966120 12:76790582-76790604 TACAAATACATGTATAGATAGGG + Intronic
1099127675 12:78785361-78785383 ATAAAATATATGGTTATATAAGG - Intergenic
1099372335 12:81850942-81850964 CACACATATATATATATGTAAGG + Intergenic
1099620195 12:84994083-84994105 CTCAGGTATATGTTTAGATATGG - Intergenic
1099657006 12:85506143-85506165 CTCAAGTATAGTTATATATTAGG + Intergenic
1099869023 12:88322696-88322718 CAGATATATATATATATATATGG + Intergenic
1099967742 12:89468696-89468718 CTTAAATATATGCATATCCATGG - Intronic
1100085879 12:90909832-90909854 CTTAAATATATATGTATATATGG - Intronic
1100161828 12:91869626-91869648 CTCATACATGTATATATATATGG - Intergenic
1100179264 12:92066771-92066793 CACACATACATGTATGTATATGG + Intronic
1100223915 12:92537180-92537202 CTGGTATATATTTATATATATGG + Intergenic
1100546688 12:95609701-95609723 CTCAAAAAAAAGAATATATAAGG + Intergenic
1100661221 12:96701158-96701180 CACAGATATATGCATATATATGG - Intronic
1100737031 12:97546724-97546746 CTGAAATATGTGTCTATACATGG + Intergenic
1101125653 12:101631265-101631287 TTCATATATATGGACATATATGG - Intronic
1101411889 12:104475777-104475799 CATATATATATGCATATATATGG - Intronic
1101594258 12:106149882-106149904 TTCAAATAAATCTATATTTATGG - Intergenic
1102065550 12:109972006-109972028 AAAAAATATATATATATATATGG + Intronic
1102579845 12:113879430-113879452 TTTATATATATATATATATATGG + Intronic
1102629161 12:114261868-114261890 ATAATATATATCTATATATAGGG - Intergenic
1102695578 12:114796801-114796823 ATAACATATATATATATATATGG + Intergenic
1102810896 12:115823367-115823389 AGCAAATGTATGTAAATATATGG - Intergenic
1103033400 12:117636340-117636362 CAAATATATATATATATATATGG + Intronic
1103383095 12:120510271-120510293 AGGAAAAATATGTATATATAAGG - Intronic
1104040330 12:125125908-125125930 CACTCATGTATGTATATATATGG + Intronic
1104120610 12:125795638-125795660 TTTAAAAATATGTAGATATATGG + Intergenic
1105203400 13:18198345-18198367 CTCGAGTGTATGTATATTTAGGG - Intergenic
1105324461 13:19357141-19357163 GTCAAATATATGATAATATATGG - Intergenic
1105989933 13:25609564-25609586 TTCAAATATATATATATATTTGG + Intronic
1106146137 13:27051513-27051535 ATCATATATATGGATATATATGG + Intergenic
1106386843 13:29295155-29295177 CACAATTGTATGTATGTATAGGG + Intronic
1106742077 13:32655358-32655380 AAAAAATATATATATATATATGG - Intronic
1106760845 13:32866081-32866103 ATAAGATATATATATATATAGGG - Intergenic
1106826790 13:33531357-33531379 GTCAAATATATTTAAATACATGG - Intergenic
1107191292 13:37589944-37589966 TTTAATTATATGTATATATATGG - Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108134872 13:47345216-47345238 CGTATATATATATATATATATGG + Intergenic
1108191267 13:47941644-47941666 CACACATATATTTACATATATGG + Intronic
1108336790 13:49451467-49451489 TATATATATATGTATATATAAGG - Intronic
1108481163 13:50873356-50873378 CCCCAATAAATATATATATATGG - Intergenic
1108936992 13:55894043-55894065 CTCAAAAGTATGTATTTATCTGG + Intergenic
1108975150 13:56432953-56432975 GTCAACTATATGGATATATTTGG - Intergenic
1109068930 13:57737818-57737840 CATATATACATGTATATATATGG + Intergenic
1109100093 13:58172823-58172845 TACAAATACATTTATATATAGGG + Intergenic
1109145936 13:58779806-58779828 ATGAAATATATGGAAATATATGG - Intergenic
1109222075 13:59650491-59650513 CAAAAAAATATATATATATATGG + Intergenic
1109241179 13:59890672-59890694 CATACATATATGTATATATGTGG - Intronic
1109325468 13:60862074-60862096 CTCAAAAATATTTATAAATGTGG + Intergenic
1109428981 13:62207267-62207289 CATATATATATATATATATATGG - Intergenic
1109569351 13:64165744-64165766 TTCTGATATATGTATATATTTGG + Intergenic
1109580159 13:64320190-64320212 CTGAAACATATGTAAACATAGGG - Intergenic
1109801542 13:67385146-67385168 TACATATATATATATATATATGG + Intergenic
1109825073 13:67708409-67708431 CTTCCATATATATATATATATGG - Intergenic
1109882807 13:68503396-68503418 CACACATATATATATATACAAGG - Intergenic
1109906043 13:68843892-68843914 CACATATATATGTATATATATGG - Intergenic
1110092919 13:71476786-71476808 TACATATATATGTATACATATGG + Intronic
1110097824 13:71552764-71552786 TGCATATATATATATATATATGG + Intronic
1110369490 13:74724407-74724429 TCCAAATATTTATATATATATGG - Intergenic
1110377490 13:74809264-74809286 CTCCCATATATATATATATATGG + Intergenic
1110444376 13:75561537-75561559 TTTCAATATATATATATATAAGG + Intronic
1110568269 13:76977795-76977817 CTCATATATGTATGTATATATGG - Intergenic
1110704023 13:78584449-78584471 AAGAATTATATGTATATATATGG - Intergenic
1111040950 13:82746549-82746571 TTCAAAAACATGTATATACATGG + Intergenic
1111094518 13:83495064-83495086 CCAAAGTATATGTATATACATGG + Intergenic
1111184088 13:84706501-84706523 CACATGTATATGTATATACAAGG - Intergenic
1111366622 13:87255135-87255157 CACACATATATATATATATATGG + Intergenic
1111393222 13:87626552-87626574 CTAAATTATGTATATATATATGG - Intergenic
1111495474 13:89043649-89043671 AACATATATATGTACATATATGG - Intergenic
1111545666 13:89732364-89732386 AGCATATATATGTGTATATATGG + Intergenic
1111796752 13:92930566-92930588 CTGGAATATATATATATATATGG - Intergenic
1111992114 13:95126877-95126899 CTTAAATATATATATATATTTGG - Intronic
1113167551 13:107459388-107459410 TACAAATATATATATATATAAGG + Intronic
1113617303 13:111689913-111689935 CTTAAATATATGTAAATTAAAGG - Intergenic
1113622832 13:111775183-111775205 CTTAAATATATGTAAATTAAAGG - Intergenic
1114138616 14:19884565-19884587 TTCAAAAAAATATATATATATGG + Intergenic
1114155763 14:20101262-20101284 TTCAAATATATATATAAATTAGG - Intergenic
1114691021 14:24581541-24581563 CATATATATATGTATATATATGG + Intergenic
1114792297 14:25673232-25673254 TTTATATATATATATATATATGG - Intergenic
1114937672 14:27563313-27563335 ATTATATATATATATATATATGG + Intergenic
1114979215 14:28141638-28141660 CTCCTATATATGAATATAGAGGG - Intergenic
1115059379 14:29171211-29171233 AAAAAATATATATATATATATGG - Intergenic
1115180042 14:30613340-30613362 ATCAAATATATTTAAATCTATGG - Intronic
1115228410 14:31129586-31129608 CTAAAATATATGTAAATTTTTGG + Intronic
1115644536 14:35359149-35359171 CTCAAAAATATACATGTATATGG + Intergenic
1116241373 14:42347346-42347368 CACACATATATGTGTATATATGG - Intergenic
1116248352 14:42448633-42448655 TTCAAATCTATCTATATACATGG - Intergenic
1116273476 14:42801629-42801651 CTCAAATATATGTTTCTGAAAGG + Intergenic
1116293302 14:43071179-43071201 GAAAAATATATATATATATATGG - Intergenic
1116497424 14:45578720-45578742 CTCAAAAAACTGCATATATAAGG - Intergenic
1116534234 14:46011508-46011530 TATAAATATATATATATATATGG + Intergenic
1116547880 14:46193294-46193316 TTTATATATATGTATATATCAGG - Intergenic
1116869671 14:50059468-50059490 CACACATACATGAATATATAGGG + Intergenic
1116941889 14:50798778-50798800 CTCAAATAAATAAATAAATAGGG - Intronic
1117333052 14:54733328-54733350 GGCATATATATGTGTATATACGG + Intronic
1117593857 14:57306286-57306308 CATAAATATATGGATAAATATGG - Intergenic
1117681814 14:58211207-58211229 TTCAAATATATTTGGATATAAGG + Intronic
1118013878 14:61638868-61638890 CCGAAATATTTGTATATAAATGG - Intronic
1118202726 14:63691833-63691855 TGAAAATATATGTATAAATAAGG - Intronic
1118216605 14:63814628-63814650 ATATAATATATGGATATATAAGG - Intergenic
1118334539 14:64841739-64841761 AAAAAATATATATATATATATGG - Intronic
1118395859 14:65335899-65335921 CTTATACATATATATATATAAGG - Intergenic
1118395860 14:65335900-65335922 CTTATATATATATATGTATAAGG + Intergenic
1119091486 14:71785570-71785592 GACATATATATGTATACATAGGG + Intergenic
1119219826 14:72897427-72897449 TTCAAATATATGAATAGCTATGG - Intergenic
1119986274 14:79141852-79141874 CTCAAACTTCTGTATATATTCGG + Intronic
1120061406 14:79987472-79987494 TTGAAATATTTTTATATATAGGG + Intergenic
1120243338 14:81975843-81975865 GTCATCTATATATATATATATGG + Intergenic
1120286736 14:82511842-82511864 CGCATATATATATACATATATGG + Intergenic
1120515102 14:85461245-85461267 CCCATATATATATGTATATATGG + Intergenic
1120570840 14:86115131-86115153 CATAAAGATATATATATATATGG + Intergenic
1120580222 14:86238433-86238455 CCCACATATATATATATATGGGG + Intergenic
1120656389 14:87195236-87195258 AGCAAACATATATATATATATGG - Intergenic
1120983548 14:90312872-90312894 TTCAAATATATTTATAAACAAGG + Intronic
1121370943 14:93357915-93357937 TCCATATATATCTATATATATGG - Intronic
1121481969 14:94285483-94285505 CACACACATATATATATATATGG - Intronic
1121773152 14:96570289-96570311 CTCACATATGTGTGTATGTATGG - Intergenic
1121938092 14:98039238-98039260 TACACATATATGTATATATACGG - Intergenic
1121955775 14:98211209-98211231 CTCAAATTCATTTATATATGAGG + Intergenic
1122533824 14:102448096-102448118 TACATGTATATGTATATATATGG - Intronic
1122715592 14:103695153-103695175 TTAAATTATATATATATATATGG + Intergenic
1122869511 14:104630573-104630595 CTCAAATATATAAATAAAAAAGG + Intergenic
1202829517 14_GL000009v2_random:11606-11628 GTCATAGATATGTATGTATAGGG - Intergenic
1202870623 14_GL000225v1_random:159805-159827 AAAAAATATATATATATATAAGG + Intergenic
1123482468 15:20645263-20645285 TTTAGATGTATGTATATATATGG + Intergenic
1123571078 15:21609861-21609883 CTCAGATAGATGAATATACATGG - Intergenic
1123607190 15:22045218-22045240 CTCAAATAGATGAATATACATGG - Intergenic
1124024645 15:25954160-25954182 CTTAAAGATATGGAGATATATGG - Intergenic
1124117403 15:26858792-26858814 TACAAATATATATATATATCTGG - Intronic
1124936903 15:34181572-34181594 TGTATATATATGTATATATATGG - Intronic
1124936904 15:34181606-34181628 CATATATATGTGTATATATATGG - Intronic
1124936905 15:34181630-34181652 CATATATATGTGTATATATATGG - Intronic
1124936907 15:34181666-34181688 CATATATATGTGTATATATATGG - Intronic
1124936911 15:34181726-34181748 GACATATATATGTGTATATATGG - Intronic
1124936913 15:34181760-34181782 CATATATATGTGTATATATATGG - Intronic
1124936915 15:34181796-34181818 CATGTATATATGTATATATATGG - Intronic
1124936919 15:34181868-34181890 TCCATATATATATATATATATGG + Intronic
1124936920 15:34181869-34181891 TCCATATATATATATATATATGG - Intronic
1125360517 15:38859885-38859907 CTGAAATATATGTAGACATGAGG - Intergenic
1125531703 15:40417857-40417879 CTCATAAGTATGTATGTATAGGG + Intronic
1125637608 15:41202470-41202492 CTCAAATATATATATATGCTGGG - Intronic
1125864119 15:43028445-43028467 GCCAAATATATGTATTTTTAAGG - Intronic
1126268976 15:46790181-46790203 CACACATGTATGCATATATATGG + Intergenic
1126290880 15:47076954-47076976 TTCATATATATATATATATTTGG + Intergenic
1126402779 15:48291246-48291268 CTCACATATATATATATATATGG - Intronic
1126433653 15:48613488-48613510 GGAAAATATATATATATATATGG - Intronic
1126460302 15:48907769-48907791 ATCATATATATATATATACACGG + Intronic
1126529299 15:49694778-49694800 CACAAACGTATATATATATATGG + Intergenic
1126601136 15:50428536-50428558 ATCATAAAAATGTATATATAGGG - Intronic
1126821872 15:52512515-52512537 AAAAAATATATATATATATAGGG + Intronic
1126896949 15:53268306-53268328 CTCATATATATGTATGTATGAGG + Intergenic
1126978230 15:54210235-54210257 TTAATATATATATATATATATGG + Intronic
1127073461 15:55304830-55304852 AACATATATATATATATATATGG + Intronic
1127238044 15:57077309-57077331 CACATATATATACATATATATGG - Intronic
1127350363 15:58145507-58145529 TTAAAAAATATATATATATATGG - Intronic
1127357135 15:58210962-58210984 TTGGAATATATATATATATATGG - Intronic
1127827118 15:62713896-62713918 AGCATATATATATATATATATGG - Intronic
1128365402 15:66996595-66996617 ATTAAATATATTTATATATATGG + Intergenic
1128646537 15:69382776-69382798 CATATATATATATATATATATGG - Intronic
1129028336 15:72600139-72600161 CCCCAATATATGTATAAACAAGG - Exonic
1129317695 15:74755381-74755403 TATATATATATGTATATATATGG - Exonic
1129765742 15:78165513-78165535 CATATATATATGTTTATATATGG - Intronic
1129977132 15:79831741-79831763 TGCTAATATATGTAAATATATGG + Intergenic
1130242376 15:82207607-82207629 TTAAAAAATATGCATATATATGG + Intronic
1130392146 15:83466409-83466431 TTAGAATATATATATATATATGG + Intronic
1131330381 15:91493070-91493092 CTAAAAAATATATATATATTTGG - Intergenic
1131575927 15:93590863-93590885 CGTGCATATATGTATATATATGG - Intergenic
1131645843 15:94342664-94342686 GATAAATATATGTGTATATATGG - Intronic
1131701244 15:94938420-94938442 TTCATATATATATATATATATGG + Intergenic
1131870180 15:96756063-96756085 TTCAAATATATTTAGCTATATGG - Intergenic
1202979430 15_KI270727v1_random:336985-337007 CTCAAATAGATGAATATACATGG - Intergenic
1133504281 16:6395690-6395712 CTGATATATAAGTATATAGATGG - Intronic
1133513168 16:6480639-6480661 CACAAATATTTATATATCTACGG + Intronic
1133531347 16:6657979-6658001 CACAAATATATCCATATATGTGG - Intronic
1133638647 16:7695730-7695752 CTCTAATAAATGTTTTTATAAGG - Intronic
1133834861 16:9358854-9358876 AACATATATATATATATATATGG - Intergenic
1134078937 16:11311717-11311739 CATATATATATATATATATATGG - Intronic
1134168163 16:11947039-11947061 ATTATATATATATATATATATGG + Intronic
1134863349 16:17581407-17581429 TAGAAATATATGTATATATCTGG - Intergenic
1135273929 16:21094663-21094685 CTCAAATATATATATATATATGG + Intronic
1135589230 16:23693284-23693306 CTCAAAAATATATATATATAGGG + Intronic
1135617746 16:23926606-23926628 CGTGTATATATGTATATATATGG + Intronic
1135911860 16:26568608-26568630 CACATATATATGTATATATTTGG - Intergenic
1136490034 16:30601621-30601643 AAAAAATATATATATATATATGG + Intergenic
1137402478 16:48164765-48164787 TACATATATATATATATATATGG - Intergenic
1137414930 16:48267298-48267320 CTCAAAAATATATATATGAATGG - Intronic
1137593621 16:49709164-49709186 TTCATATATATATATATAAACGG - Intronic
1137749179 16:50846243-50846265 CTCAAATATATGTCTATATTTGG - Intergenic
1137824469 16:51479169-51479191 TACACATATATATATATATATGG - Intergenic
1138108160 16:54302188-54302210 CATATATATATATATATATATGG + Intergenic
1138708355 16:58940735-58940757 TTCATATATATAAATATATATGG - Intergenic
1138710505 16:58965487-58965509 CTCTAAAATATGTATGTACAGGG - Intergenic
1138862922 16:60780645-60780667 CATATATATATGTAAATATATGG + Intergenic
1138894514 16:61187411-61187433 CACACATATATGTTTATATGAGG + Intergenic
1139198995 16:64953293-64953315 CACACACATATATATATATATGG + Intronic
1139212772 16:65096685-65096707 CAAATATATATGTATATATTTGG + Intronic
1139409070 16:66744533-66744555 CTCAAATAAATGAATAAATTTGG - Intronic
1139445148 16:66993280-66993302 CGCATATGTATGTATGTATATGG + Intronic
1139562529 16:67752640-67752662 TGTAAATATATATATATATAAGG - Intronic
1140088519 16:71817952-71817974 CTCGAAAATATGTATAAATGTGG + Intergenic
1140161088 16:72495463-72495485 ATCATGTATATGTATACATATGG + Intergenic
1140558996 16:75955427-75955449 CCAAAATATATATATATATTTGG + Intergenic
1140641733 16:76981874-76981896 TATATATATATGTATATATATGG + Intergenic
1141064576 16:80903634-80903656 CACACATATATGCATGTATAAGG + Intergenic
1141095168 16:81158088-81158110 CTCAAAAAAATACATATATATGG + Intergenic
1141233296 16:82191426-82191448 TTCAAAAATATATATATATTAGG - Intergenic
1141433523 16:83983971-83983993 GTAAAATACATATATATATATGG + Intronic
1142650125 17:1343849-1343871 CTTAAATATTTGTATGTATCTGG - Intergenic
1142784198 17:2207636-2207658 CACAAATGTATGGATATAAAGGG + Intronic
1144381901 17:14707662-14707684 CATATATATATATATATATATGG + Intergenic
1144594776 17:16559940-16559962 GAAAAATATATATATATATATGG - Intronic
1144932652 17:18872317-18872339 CTCAACTGTTTGTATATATAAGG + Intronic
1145357890 17:22180039-22180061 ATAATATGTATGTATATATATGG - Intergenic
1145815402 17:27791800-27791822 AACAAAAATATATATATATATGG + Intronic
1145873683 17:28298883-28298905 CATACATATATATATATATATGG + Intergenic
1146105853 17:30036061-30036083 ATAAAATATATATAAATATATGG - Intronic
1146432267 17:32809016-32809038 CACACACATATGTATATTTAGGG + Intronic
1146486573 17:33247906-33247928 CTGAAGTATATGTGTATGTACGG + Intronic
1146609582 17:34292430-34292452 AAAAAATATATATATATATATGG - Intergenic
1146695421 17:34905531-34905553 CTAAAATATTTCTATATTTAAGG - Intergenic
1146775252 17:35608676-35608698 CTTAAATATATATAAATTTACGG - Intronic
1146828386 17:36044935-36044957 TTAAAATATATATATATATATGG - Intergenic
1146962075 17:36990091-36990113 CAAATATATATGTATAAATATGG + Intronic
1147437223 17:40424357-40424379 CACATATATGTGTATATATATGG + Intergenic
1147871363 17:43589793-43589815 ATAAACTATATATATATATATGG - Intergenic
1148428057 17:47617495-47617517 AAAAAATATATATATATATATGG - Intronic
1148602085 17:48901803-48901825 CATATATATATATATATATATGG - Intergenic
1148602086 17:48901804-48901826 CATATATATATATATATATATGG + Intergenic
1148602087 17:48901848-48901870 TATATATATATGTATATATATGG - Intergenic
1148602090 17:48901899-48901921 TATATATATATGTATATATATGG - Intergenic
1148602092 17:48901948-48901970 TATATATATATGTATATATATGG - Intergenic
1148602095 17:48902009-48902031 TATATATATATGTATATATATGG - Intergenic
1148602098 17:48902070-48902092 AATATATATATGTATATATATGG - Intergenic
1149340775 17:55683994-55684016 CAAAAATATATATATATTTAGGG - Intergenic
1149769418 17:59308492-59308514 TATATATATATGTATATATATGG + Intergenic
1149965462 17:61159033-61159055 ATAAAATGTATGAATATATATGG - Intronic
1150097646 17:62392074-62392096 CACAAATATATATATATTTGGGG - Intronic
1150115771 17:62548226-62548248 CACACACATATATATATATATGG - Intronic
1150330405 17:64289712-64289734 TTAAAATATATATATATATATGG + Intergenic
1150353375 17:64462946-64462968 ATAAAAAATATGTATATATTAGG - Intronic
1150479443 17:65498046-65498068 CTCAAATGTATGAGTACATATGG + Intergenic
1150589756 17:66551769-66551791 CTCATATATATATATAAATTAGG - Intronic
1150660757 17:67075446-67075468 TACATATATATGCATATATAAGG + Exonic
1150719294 17:67600893-67600915 CTCAAATATACGTTGATGTAAGG - Intronic
1150763442 17:67984197-67984219 TTCATATATATAAATATATATGG + Intronic
1150855267 17:68746222-68746244 CTAAGATATATGTATAGAAACGG + Intergenic
1150869328 17:68887908-68887930 ATATAATATATATATATATATGG - Intronic
1150890738 17:69146021-69146043 CTCATATATATTATTATATATGG - Intergenic
1150892938 17:69175716-69175738 CTCAATTTTATATGTATATACGG + Intronic
1150899064 17:69250348-69250370 CACAGAGATATATATATATATGG + Intronic
1151001690 17:70384014-70384036 TTCATAGATAGGTATATATATGG - Intergenic
1151004744 17:70421395-70421417 CTCAAAGATATGTTTCTTTATGG + Intergenic
1151041711 17:70869241-70869263 TACATATATATATATATATATGG - Intergenic
1151321491 17:73355158-73355180 AAAAAATATATATATATATATGG - Intronic
1151625961 17:75275971-75275993 AAAAAATATATATATATATATGG + Intronic
1152342343 17:79732153-79732175 CACACATATATATATATATGAGG + Intronic
1153147892 18:2054704-2054726 ATCATATATATTTATACATATGG - Intergenic
1153761749 18:8338278-8338300 TAAAAATATATATATATATATGG + Intronic
1153879990 18:9413527-9413549 CTCAAAAAAATATATATATTTGG + Intergenic
1154055350 18:11008067-11008089 GTGCAATATATGTATATATGAGG + Intronic
1154124465 18:11677758-11677780 CACGAATTTATGTATGTATAGGG + Intergenic
1154205461 18:12332668-12332690 AAAAAATATATATATATATATGG - Intronic
1154942087 18:21124283-21124305 CTAAAAAATATATGTATATATGG - Intergenic
1155105333 18:22659380-22659402 CTCAAAATTATGTAAATACATGG + Intergenic
1155418751 18:25630595-25630617 CTTAAATAAATGGATAGATATGG + Intergenic
1155573595 18:27221457-27221479 CTCAAAACTATGCAAATATATGG - Intergenic
1155582948 18:27332020-27332042 CACATATATATGTATGTACATGG + Intergenic
1155668617 18:28342099-28342121 ATGAAATATATGTAATTATATGG + Intergenic
1155733116 18:29186344-29186366 CATACATATATGTATATATATGG - Intergenic
1155743571 18:29321433-29321455 TTCAAAAATATATATATTTATGG + Intergenic
1155765145 18:29621006-29621028 AATATATATATGTATATATATGG - Intergenic
1155856064 18:30836368-30836390 ATCATATATATGTATGTATCTGG - Intergenic
1155861579 18:30907883-30907905 ATAACATATATATATATATATGG + Intergenic
1156202522 18:34850818-34850840 CACAAACAGATATATATATATGG + Intronic
1156304188 18:35861435-35861457 CACATATATATGTATATAAAGGG - Intergenic
1156649290 18:39205477-39205499 CTGGAAAATATGTATATTTATGG - Intergenic
1157044156 18:44077384-44077406 TTCAAATATATGAAAATATAAGG - Intergenic
1157046788 18:44109763-44109785 ATCACATGTATGTATACATACGG + Intergenic
1157253036 18:46113074-46113096 AAAAAATATATATATATATATGG - Intronic
1157471913 18:47995327-47995349 CATAAAAATATGTACATATATGG - Intergenic
1158014984 18:52773828-52773850 TTAAAAAATATATATATATATGG - Intronic
1158061059 18:53342728-53342750 CAAATATATATATATATATATGG + Intronic
1158468348 18:57712048-57712070 CATATATATATATATATATATGG + Intronic
1158879794 18:61766399-61766421 CAAAAATATGTGTATGTATAAGG + Intergenic
1158979828 18:62749211-62749233 TCTAAATAAATGTATATATAAGG + Intronic
1158991175 18:62870323-62870345 ATTAAATATATGTATATAAGAGG - Intronic
1159153189 18:64546891-64546913 CTCAAAAGAAGGTATATATATGG - Intergenic
1159249697 18:65858647-65858669 ATCATGTATATGTATATATTTGG + Intronic
1159295911 18:66488341-66488363 CACATATATATGTACATACATGG - Intergenic
1159302405 18:66592095-66592117 CTCAAATGTATGTATATGGGAGG - Intronic
1159377134 18:67606744-67606766 CTCATACATATGTATATATCTGG - Intergenic
1159391092 18:67792486-67792508 TACATATATATATATATATAAGG - Intergenic
1159405267 18:67993625-67993647 CACATTTATAGGTATATATATGG + Intergenic
1159419131 18:68193332-68193354 CTCAAAACTATATAAATATATGG - Intergenic
1159467908 18:68809323-68809345 CTCAAATATAAATATTTATATGG - Intronic
1159527859 18:69617070-69617092 AACAAATATATGGATATACAAGG - Intronic
1159610905 18:70524676-70524698 CTCAACCATATATATAAATATGG + Intergenic
1159656849 18:71040141-71040163 CTAACATATATATATATATATGG - Intergenic
1159759180 18:72403565-72403587 CTAAAATAAATATATAAATAAGG + Intergenic
1159921467 18:74230847-74230869 CTCCAATATTTTTATATTTATGG - Intergenic
1159987999 18:74868310-74868332 CACAAATATGTGTATGTCTATGG - Intronic
1160066567 18:75580693-75580715 CTATACTATATATATATATATGG + Intergenic
1160278612 18:77464540-77464562 TTGAAATGTATGTATATACAGGG - Intergenic
1160801151 19:969990-970012 TAAAAAAATATGTATATATAGGG - Intronic
1161245008 19:3246395-3246417 CTCATATGTATATATATATATGG + Intronic
1161927968 19:7315459-7315481 TTAAAATATATGTAAATGTATGG - Intergenic
1162196996 19:8992540-8992562 CACATATATATATATATATTAGG - Intergenic
1162290382 19:9775640-9775662 CAAAAATATATGCATATGTAGGG + Intronic
1162329053 19:10015961-10015983 AAAAAATATATATATATATATGG + Intronic
1163205695 19:15801055-15801077 TATATATATATGTATATATATGG - Intergenic
1163553362 19:17978600-17978622 TTTATATATCTGTATATATAAGG - Intronic
1163806000 19:19398201-19398223 CTCAAATAAATAAATAAATAAGG - Intronic
1163960394 19:20684687-20684709 CTCCAATAAATGTAAATATATGG - Intronic
1164458821 19:28430512-28430534 CTAATATATCTATATATATATGG + Intergenic
1164568793 19:29353155-29353177 ATCAGATAGTTGTATATATATGG - Intergenic
1164858506 19:31543958-31543980 CTTAAATATATTTAAATATTAGG + Intergenic
1165163989 19:33837974-33837996 CATATATATATATATATATATGG - Intergenic
1165163990 19:33838000-33838022 AACATATATATATATATATATGG - Intergenic
1165163991 19:33838024-33838046 AACATATATATATATATATATGG - Intergenic
1165659067 19:37558809-37558831 CTTCACTATATATATATATATGG + Intronic
1165659507 19:37563841-37563863 GTGGAATATATGTATATATATGG + Exonic
1165717731 19:38057351-38057373 CGTATATATATGTATATATATGG + Intronic
1166200235 19:41232677-41232699 CTCACAGATCTGTAAATATAAGG + Intronic
1167397045 19:49236660-49236682 TTAAAATAAATATATATATAAGG - Intergenic
1167451479 19:49572671-49572693 TTAAAATATATATATATATATGG + Intronic
1167803888 19:51765924-51765946 CTAAAATATATATATATACTGGG - Intronic
1168015154 19:53566951-53566973 CACATACACATGTATATATATGG - Intronic
1202643177 1_KI270706v1_random:116175-116197 GTCATAGATATGTATGTATAGGG + Intergenic
925093499 2:1174288-1174310 CATATATATATATATATATATGG - Intronic
925655202 2:6139612-6139634 TTCACATGTATGTATATATGTGG - Intergenic
925677662 2:6382540-6382562 TTCAAAAATATATATATAGATGG + Intergenic
926000161 2:9324224-9324246 CTAAGATATATGTATTTATAAGG - Intronic
926268837 2:11349640-11349662 CTCAAATATATACATTTACACGG - Intergenic
926398555 2:12470740-12470762 AAAATATATATGTATATATATGG + Intergenic
926450577 2:12999123-12999145 CACACATATATATATATATTAGG - Intergenic
926453398 2:13035459-13035481 CACACATATATATATATATATGG + Intergenic
927227127 2:20778922-20778944 CATATATATATATATATATATGG + Intronic
927324716 2:21791026-21791048 CACAAATATGGGTATATTTAGGG - Intergenic
927378600 2:22450474-22450496 CATATGTATATGTATATATATGG - Intergenic
927457173 2:23263047-23263069 CTCATATATATGTATGTATATGG - Intergenic
927526576 2:23747297-23747319 ATTACACATATGTATATATATGG - Intergenic
927750367 2:25663634-25663656 ATAAAATATATGGAAATATATGG - Intronic
927966484 2:27273047-27273069 AAAAAATATATATATATATATGG + Intronic
928192119 2:29180863-29180885 CACATGTATATATATATATATGG + Intronic
928715771 2:34058477-34058499 CTTAAATATATATATATTTAAGG - Intergenic
928813535 2:35259442-35259464 ATCAAATATATGTAGATAAAGGG + Intergenic
928831167 2:35485556-35485578 CACATAAATATATATATATATGG - Intergenic
929708741 2:44244186-44244208 TTGAAATATATATATATATATGG - Intronic
930808667 2:55518666-55518688 AAAAAATATATATATATATATGG + Intergenic
931016430 2:57986527-57986549 TGCAAATATATGTATATATGTGG - Intronic
931933867 2:67173395-67173417 CCCAAATATATGTATATATTTGG - Intergenic
931945585 2:67302869-67302891 CACATAAATATGTACATATAAGG + Intergenic
932039190 2:68281131-68281153 TTCAAATAAATGTATAACTAAGG + Intergenic
932090626 2:68802927-68802949 CACACACATATGTGTATATATGG - Intronic
932097581 2:68865248-68865270 CTCAAATGTATGCATATTAAAGG - Intergenic
932189378 2:69726887-69726909 AGCAAATATATATATATACAGGG + Intronic
932867495 2:75360565-75360587 CCAAAAGATATATATATATATGG + Intergenic
932894693 2:75627551-75627573 ATAAAATATATGTACATACATGG + Intergenic
932919659 2:75896654-75896676 CTCAAAAATCTGTAAATTTATGG + Intergenic
932984857 2:76713443-76713465 CACAAATGTATGTAAATATGTGG - Intergenic
933043250 2:77497652-77497674 CACATATATCTGTGTATATATGG + Intronic
933049348 2:77583381-77583403 TTAAAATATATATATATAAAAGG + Intronic
933108068 2:78358753-78358775 AGAAGATATATGTATATATATGG - Intergenic
933223273 2:79715731-79715753 AAGAAATATATGTATAAATATGG + Intronic
933353971 2:81192347-81192369 TCCATATATATATATATATATGG + Intergenic
933353972 2:81192348-81192370 TCCATATATATATATATATATGG - Intergenic
933403733 2:81831254-81831276 CTTAAATATATGAATATTAAAGG + Intergenic
933513575 2:83272379-83272401 TTTATATATATATATATATATGG - Intergenic
933636709 2:84716138-84716160 CCCATATATATACATATATATGG + Intronic
933636710 2:84716139-84716161 CCCATATATATGTATATATATGG - Intronic
933875388 2:86615518-86615540 ATTATATATATATATATATAAGG - Intronic
934482229 2:94661769-94661791 CTAGAATCTATGGATATATAGGG + Intergenic
935282490 2:101530547-101530569 ATAAAATATATATGTATATATGG - Intergenic
935440338 2:103087292-103087314 CATACATATATATATATATATGG + Intergenic
935551378 2:104461211-104461233 CTCACATATATTAATATCTATGG - Intergenic
935729080 2:106050054-106050076 ATAATATATATATATATATATGG - Intergenic
935973233 2:108551962-108551984 TATATATATATGTATATATATGG + Intronic
936405296 2:112197463-112197485 CTGAAATAAAGGTATATACAGGG - Intergenic
936702156 2:115024689-115024711 AACAAATATATATATATTTAAGG - Intronic
936718354 2:115216835-115216857 CACATATATTTGTCTATATATGG - Intronic
936734259 2:115421235-115421257 CTCATATATTTGTATATTTCTGG - Intronic
936838747 2:116742314-116742336 TACACATATATATATATATATGG + Intergenic
937039721 2:118811572-118811594 CACAGCTATATGTATAAATATGG - Intergenic
937216704 2:120317683-120317705 CTCATATATATATATATACTAGG + Intergenic
937457996 2:122060404-122060426 CTAACATATATATGTATATATGG + Intergenic
937652950 2:124340909-124340931 CACATATATATATATATATTAGG + Intronic
937832119 2:126435411-126435433 ATTATATATATATATATATAAGG + Intergenic
938175355 2:129121638-129121660 CTCAAAGCCATGCATATATATGG - Intergenic
938391069 2:130906345-130906367 CATAAATATGTGTGTATATATGG - Intronic
938563649 2:132497048-132497070 CTAAAAGATATGCATGTATAAGG - Intronic
938891970 2:135714736-135714758 GTGATATATATGTATATATATGG + Intronic
938956632 2:136304946-136304968 CTGATATATATGTGTATATATGG + Intergenic
939625786 2:144475466-144475488 CATATGTATATGTATATATATGG - Intronic
939740107 2:145896095-145896117 AATAAATATATATATATATATGG - Intergenic
939790651 2:146570060-146570082 CACACATATATGCACATATATGG + Intergenic
939911339 2:147987348-147987370 CACATATATATATCTATATATGG - Intronic
940623649 2:156145886-156145908 CTCAAATGTATACATATATAGGG + Intergenic
940632136 2:156253510-156253532 CACATATATATGTATATATATGG - Intergenic
940866939 2:158826493-158826515 AAAAAATATATATATATATATGG - Intronic
941097806 2:161260423-161260445 GTGAAATGTGTGTATATATATGG + Intergenic
941219506 2:162758526-162758548 CGTATATATATGTATATATGTGG + Intronic
941607897 2:167622973-167622995 CTCAAATATATTGTTACATATGG + Intergenic
941972643 2:171368868-171368890 CTTAAAAAAATATATATATATGG + Intronic
942016497 2:171822382-171822404 CTCAAATAAATAAATAAATAGGG - Intronic
942371880 2:175294213-175294235 CTTAAAAATATATATATATGGGG - Intergenic
942666636 2:178326378-178326400 ACCAAAAATATGTATATATCTGG + Intronic
943089245 2:183354428-183354450 CACATATATATACATATATATGG + Intergenic
943206333 2:184901867-184901889 CTCATATATATAAATACATATGG - Intronic
943299048 2:186174296-186174318 CACACATATATATATATATATGG + Intergenic
943456117 2:188109387-188109409 CTTATATATTTGTAGATATAAGG - Intergenic
943502818 2:188712912-188712934 CACATATATATATATATATGGGG - Intergenic
943502820 2:188712914-188712936 CACACATATATATATATATATGG - Intergenic
943914350 2:193609720-193609742 CTCAAATATTTGCATAGATAGGG + Intergenic
943922592 2:193728675-193728697 TGCATATATATGTACATATATGG + Intergenic
943967097 2:194350774-194350796 CATAAATAAATATATATATATGG + Intergenic
944020063 2:195092034-195092056 CACACATATATATATATATATGG + Intergenic
944085817 2:195847058-195847080 CAGATATATATATATATATATGG - Intronic
944144474 2:196491531-196491553 CACACATATATATGTATATATGG + Intronic
944359351 2:198834226-198834248 CTCAAATGTATTTGTATGTATGG - Intergenic
944381810 2:199119159-199119181 CACAAAAATCTGTATTTATAAGG - Intergenic
944424087 2:199561366-199561388 ATCAAATAGTTGTAGATATATGG + Intergenic
944810185 2:203320085-203320107 ATCAAATTCATGAATATATATGG + Intergenic
944934484 2:204553563-204553585 TATATATATATGTATATATAAGG + Intronic
944934485 2:204553591-204553613 TACATATATATGTATATATATGG + Intronic
945118996 2:206439550-206439572 CTTAAATATATATATATGTAAGG - Intergenic
945118997 2:206439551-206439573 CTTACATATATATATATTTAAGG + Intergenic
945416551 2:209579992-209580014 AACATATATATATATATATATGG - Intronic
945581237 2:211597448-211597470 ATCAAATAGATGTATATGTGTGG - Intronic
945648733 2:212535234-212535256 CTCATATATATATATATAAAAGG - Intronic
945774768 2:214092502-214092524 TATAAATATATATATATATATGG + Intronic
945781424 2:214177914-214177936 TACATATATATATATATATATGG + Intronic
945834997 2:214829031-214829053 CTTTGTTATATGTATATATAGGG + Intergenic
946043034 2:216798741-216798763 CACAAATATATACATATATAAGG - Intergenic
946476749 2:220013638-220013660 ATCATAGGTATGTATATATAGGG - Intergenic
946499619 2:220232624-220232646 GCCAAATATATGAATATAAATGG + Intergenic
946597687 2:221324583-221324605 CACAAATAGCTGTATATTTATGG - Intergenic
946604983 2:221393687-221393709 TTAAAATTTTTGTATATATATGG - Intergenic
946613957 2:221489289-221489311 CTTAAATATATGTGGATATACGG + Intronic
946652337 2:221906890-221906912 CATACATATATGTGTATATAAGG - Intergenic
946798944 2:223389085-223389107 ATAATATATATGCATATATATGG + Intergenic
946825242 2:223671169-223671191 TTAAAATATATGCATACATATGG + Intergenic
947102828 2:226639593-226639615 CTCAAACATATTTATACAAATGG + Intergenic
947159266 2:227195651-227195673 CACACATATATATATATATGTGG - Intronic
947439943 2:230110470-230110492 CACATATACATATATATATATGG + Intergenic
947450769 2:230206541-230206563 CTCATATATATACATATATCTGG + Intronic
947479261 2:230482693-230482715 TTTACATATATATATATATAGGG + Intronic
947979510 2:234397153-234397175 TACAAATATATAAATATATAAGG + Intergenic
948253235 2:236547425-236547447 CACAAATATATGTATAAAGTTGG + Intergenic
948842300 2:240658531-240658553 GTGAAATATATATATATATATGG - Intergenic
948842886 2:240664567-240664589 TATAAATATATGTATATACATGG - Intergenic
1169451546 20:5716258-5716280 CCCAACTAAATGTATATATTAGG - Intergenic
1169623075 20:7529712-7529734 CTCAAAACTATATAAATATATGG + Intergenic
1169672757 20:8121966-8121988 CATATATATATGTATATATTTGG + Intergenic
1169915596 20:10679756-10679778 CTCAAATAAATAAATAAATAAGG + Intergenic
1169927974 20:10802817-10802839 GACATATATATATATATATATGG - Intergenic
1170101627 20:12707225-12707247 ATCAAATGTATCTATATTTATGG - Intergenic
1170154099 20:13253861-13253883 CACACATATATATATATATATGG - Intronic
1170284039 20:14685122-14685144 TTTATATATATGTATATATTTGG - Intronic
1170336238 20:15273416-15273438 TTCATATATATATATATATATGG - Intronic
1171237283 20:23537338-23537360 CACAGAAATATGCATATATAAGG - Intergenic
1171515764 20:25732951-25732973 CTCATAAATATAAATATATAAGG - Intergenic
1171538530 20:25922550-25922572 ATTAATTATATATATATATATGG - Intergenic
1171806544 20:29685944-29685966 CACATACATATATATATATATGG + Intergenic
1171890294 20:30706379-30706401 ATCATAGATATGTATGTATAGGG + Intergenic
1172491134 20:35338888-35338910 AAAAAATATATATATATATATGG + Intronic
1173376649 20:42490224-42490246 CTCTAATAAATATATATAGAGGG - Intronic
1173491113 20:43482703-43482725 TTTATATATATATATATATATGG - Intergenic
1173863807 20:46301508-46301530 TATATATATATGTATATATATGG + Intronic
1173937360 20:46878736-46878758 TATATATATATGTATATATATGG - Intergenic
1174473097 20:50775707-50775729 ATGGAATATATTTATATATATGG - Intergenic
1174728639 20:52891744-52891766 CATAAATATATATCTATATATGG + Intergenic
1174954508 20:55082262-55082284 ATTACATATATGTATATATAGGG - Intergenic
1175038822 20:56026390-56026412 ATAAAATATATATGTATATATGG + Intergenic
1175103768 20:56599248-56599270 CACATATATGTGTATATATATGG + Intergenic
1175255554 20:57644564-57644586 GATAAATATATGTATAAATATGG + Intergenic
1175411618 20:58773790-58773812 CATATATATATGTATATATATGG - Intergenic
1175708036 20:61195750-61195772 GTCAAATATATCAATATAAAAGG + Intergenic
1175735465 20:61383336-61383358 GTGATATATATGAATATATATGG + Intronic
1176608702 21:8856448-8856470 GTCATAGATATGTATGTATAGGG - Intergenic
1177027499 21:15937675-15937697 CACAAATAAATATATATAAATGG - Intergenic
1177053297 21:16266476-16266498 CTCAAAAATATGTAATAATAAGG + Intergenic
1177259346 21:18709244-18709266 ATAAAAAATATGTGTATATATGG + Intergenic
1177264898 21:18769924-18769946 CAGAAACATATATATATATATGG - Intergenic
1177343157 21:19831855-19831877 CTAAAATATAATTATATCTAAGG - Intergenic
1177399706 21:20587032-20587054 CACATATATATGTGCATATATGG - Intergenic
1177534900 21:22412409-22412431 CACAAATATATATACATATGAGG - Intergenic
1177535513 21:22422177-22422199 CACATATATATATATATAAATGG + Intergenic
1177551558 21:22629262-22629284 CATATATATATATATATATATGG + Intergenic
1177611161 21:23450274-23450296 CATATATATATATATATATATGG - Intergenic
1177903686 21:26949178-26949200 ATCACACATATATATATATATGG + Intronic
1178197130 21:30358793-30358815 TTCAGATATATAAATATATATGG + Intronic
1178218921 21:30633101-30633123 ATCAAATAACTGCATATATATGG - Intergenic
1178243507 21:30929725-30929747 CATAAATATATATGTATATATGG - Intergenic
1178337625 21:31757905-31757927 CTAAAATAAATATATATATTTGG - Intergenic
1178731857 21:35110989-35111011 TCCATATATATGTTTATATATGG + Intronic
1178909456 21:36662712-36662734 CACATACATATATATATATATGG + Intergenic
1179103082 21:38374003-38374025 CTGAAAAATATGTAAATATTGGG - Intergenic
1179340158 21:40500259-40500281 ATGAAATATATGTATTTAAAGGG - Intronic
1180589813 22:16927913-16927935 ATAAATTATATATATATATAAGG + Intergenic
1182002514 22:26931538-26931560 CATATATATATATATATATATGG + Intergenic
1182034217 22:27185106-27185128 TGTATATATATGTATATATATGG - Intergenic
1182172006 22:28240437-28240459 TACAGATATATGTATATAAATGG + Intronic
1182406928 22:30142284-30142306 CTCAAAAAAAAGTAAATATATGG + Intronic
1182467619 22:30527159-30527181 CACACACATATCTATATATATGG + Intronic
1182661920 22:31931257-31931279 TGTATATATATGTATATATATGG - Intergenic
1183800040 22:40154925-40154947 CTCTAAAATATATATATATTTGG + Intronic
949174481 3:1042922-1042944 GGGAAATATATATATATATATGG - Intergenic
949174483 3:1042943-1042965 GGGAAATATATATATATATATGG - Intergenic
949197410 3:1329202-1329224 TGCATATACATGTATATATATGG + Intronic
949359582 3:3217406-3217428 GTCAAAAATATGTATGTATCAGG - Intergenic
949384609 3:3486754-3486776 TTCAAATTGATTTATATATAAGG + Intergenic
949587254 3:5454013-5454035 CTTATATAGATGTATATGTATGG - Intergenic
949737381 3:7189151-7189173 TACAAATGTATGTATATATGTGG + Intronic
949870822 3:8586819-8586841 ATAGAATAGATGTATATATAGGG + Intergenic
950562398 3:13741390-13741412 CTCAAATGGCTGTATGTATATGG + Intergenic
950924046 3:16722413-16722435 CACATATATGTATATATATATGG + Intergenic
951038146 3:17956621-17956643 ATAATATATATGGATATATATGG + Intronic
951062908 3:18231253-18231275 TTCAAATAGATTTATAAATATGG - Intronic
951114906 3:18848187-18848209 ATCAAATATATTTAAATATTTGG + Intergenic
951301445 3:21002778-21002800 TACAAATTTATATATATATATGG - Intergenic
951635939 3:24777324-24777346 ACCAACAATATGTATATATAAGG - Intergenic
951857878 3:27217885-27217907 ATCATAGATATGTATATCTAGGG - Intronic
951918338 3:27825454-27825476 CAGAAATTTATGTATATAGATGG - Intergenic
952029351 3:29122337-29122359 CTGAAATATATGTTTCTATTAGG + Intergenic
952184096 3:30949793-30949815 CACACATATATATATATATATGG + Intergenic
952350056 3:32526061-32526083 TACATATATATATATATATATGG - Exonic
952379466 3:32793404-32793426 GTAATATATATGTAAATATATGG + Intergenic
952459350 3:33507952-33507974 CACATATATATATATATATTTGG - Intronic
952474195 3:33689241-33689263 CATAAATATAGGTATTTATATGG - Intronic
952536556 3:34316661-34316683 CTAAAATAAATATATATAAAAGG - Intergenic
952551565 3:34484570-34484592 AAAAAATATATATATATATATGG - Intergenic
952643229 3:35623704-35623726 TTGAAATATATGCATATATAGGG + Intergenic
952863567 3:37835093-37835115 ATCATAGATATGTATGTATAGGG + Intergenic
953779036 3:45849873-45849895 CTTAAATATCTGCATATATAAGG + Intronic
954273102 3:49524679-49524701 CTCAAAAAAATGTATATTTAAGG + Intronic
954311518 3:49772349-49772371 ATAAAATATATATATATAGAAGG + Intronic
955115207 3:55991516-55991538 TTCAAGTATATGTATTTAAAAGG + Intronic
955306276 3:57836147-57836169 CTAACATATATGTATTTATAGGG - Intronic
955527808 3:59838934-59838956 ATCAATTATATTTATATATTTGG + Intronic
955612634 3:60774270-60774292 ATCATAAATATGTATATATAGGG - Intronic
955680891 3:61500677-61500699 CTCAAAGAGATTTTTATATATGG + Intergenic
956078365 3:65530848-65530870 CACACACATATATATATATATGG + Intronic
956110587 3:65866622-65866644 CTCATTTATATATATACATAGGG + Intronic
956277003 3:67513001-67513023 CTCTAATATCTCTATATATCTGG - Intronic
956326946 3:68063403-68063425 CTAAAACATATGTATAATTATGG - Intronic
956484247 3:69704647-69704669 TATAAAAATATGTATATATAAGG - Intergenic
956706569 3:72004264-72004286 CTCAAATGTATGTAAATCTTTGG - Intergenic
956770816 3:72524519-72524541 ATCAAATACACATATATATAAGG + Intergenic
957056583 3:75447850-75447872 TACATATATATGTGTATATATGG + Intergenic
957153476 3:76517199-76517221 CTCACATATATGTACATACATGG - Intronic
957231588 3:77524278-77524300 ATTGAATATATATATATATATGG + Intronic
957301363 3:78395667-78395689 CCCAAATTTATGAATATATTTGG - Intergenic
957336937 3:78842546-78842568 CTCATATATATAAATATATATGG - Intronic
957336938 3:78842569-78842591 CTCATATATAAATATATAAATGG - Intronic
957677329 3:83384895-83384917 ATATAATTTATGTATATATATGG + Intergenic
957769097 3:84665092-84665114 TATAAATATATTTATATATAAGG - Intergenic
957796438 3:85015132-85015154 AACACATATATGTGTATATATGG + Intronic
957853544 3:85843541-85843563 CTCAAATAAATATTTATATGAGG + Intronic
957908642 3:86591477-86591499 CTCAACTTTATATAAATATATGG + Intergenic
957925268 3:86801439-86801461 ATTATATATATGTATATATATGG - Intergenic
958021002 3:87995604-87995626 CAGAAATATATATATATATTTGG + Intergenic
958031534 3:88116625-88116647 TGTATATATATGTATATATATGG + Intronic
958072609 3:88633729-88633751 GGCAAATATATGGAAATATAAGG + Intergenic
958137127 3:89508686-89508708 GTAAAATAAATATATATATATGG + Intergenic
958453031 3:94297453-94297475 CACATATATACGTATATATGGGG - Intergenic
958785329 3:98591965-98591987 TACATATATATATATATATATGG - Intronic
958908510 3:99967809-99967831 CTCAAAATCATGTATATAAAAGG - Intronic
959135420 3:102412809-102412831 CACATATGTGTGTATATATAGGG - Intronic
959523481 3:107347497-107347519 CTCAAGTATATGTAAATTTACGG - Intergenic
959634408 3:108547079-108547101 CAGACATATATATATATATATGG - Intergenic
959855061 3:111143543-111143565 CTTATAAATATGTATTTATATGG + Intronic
960212932 3:114992586-114992608 GACAAATATATGGATATATGTGG - Intronic
960252785 3:115474980-115475002 TACATATATATATATATATATGG + Intergenic
960392037 3:117089425-117089447 TTTATATATATATATATATATGG + Intronic
960905673 3:122598834-122598856 CTCTAATATTTCTATATAGATGG - Intronic
961054089 3:123772629-123772651 TTCAAATATATGTGTAAAAAAGG + Intronic
962798526 3:138869683-138869705 AAAAAATATATATATATATATGG - Intergenic
963308272 3:143678313-143678335 TTCAAATATATCTATATTTATGG + Intronic
963358326 3:144238434-144238456 CACACACATATATATATATATGG - Intergenic
963447344 3:145429246-145429268 CATATATATATATATATATATGG + Intergenic
963538109 3:146553850-146553872 CACACATATATGTATATATGAGG + Intergenic
963700759 3:148623137-148623159 CCTACATATATGTATATATAGGG - Intergenic
964139454 3:153380021-153380043 CTCAAATATATGCATCTAATTGG + Intergenic
964723244 3:159788848-159788870 CTCAATTTTATATATATGTAAGG - Intronic
964786886 3:160406271-160406293 CTCAATTAAATTTATAGATAAGG + Intronic
964811908 3:160674082-160674104 CACAAAGATATGTATGTATATGG - Intergenic
964920259 3:161887446-161887468 CACATATATATATATATATATGG + Intergenic
964955801 3:162354342-162354364 CTGATATATATATATATATATGG + Intergenic
965001040 3:162953838-162953860 CTCAAATTTATGTCCATATATGG - Intergenic
965072933 3:163938903-163938925 CTTAAATATATTCACATATATGG + Intergenic
965156800 3:165070344-165070366 CATATATATATATATATATATGG - Intronic
965191968 3:165542377-165542399 ATCACAAGTATGTATATATAGGG - Intergenic
965242690 3:166223921-166223943 CACATATAGATGTATATATTTGG + Intergenic
965730434 3:171766159-171766181 CTCAAATTTGTATATATTTAAGG - Intronic
965842418 3:172922183-172922205 CACAAATATATCTAAATATCAGG - Intronic
965882937 3:173409252-173409274 TTGATATATATGTATACATATGG - Intronic
965947221 3:174257900-174257922 TTTATATATATATATATATAAGG - Intronic
965995876 3:174882916-174882938 TGTATATATATGTATATATATGG + Intronic
966066145 3:175824501-175824523 TTCAAAATTTTGTATATATAGGG - Intergenic
966102461 3:176288341-176288363 TTCAAGTATATCTACATATAAGG + Intergenic
966470458 3:180283190-180283212 TTCAAATATATATATATTTTTGG - Intergenic
966638758 3:182164976-182164998 TTGAAATATATTTATATATTGGG - Intergenic
966821853 3:183931023-183931045 ATCATAGGTATGTATATATAGGG - Intronic
966897162 3:184454142-184454164 CTCAAATATATATATATATATGG - Intronic
967307293 3:188071349-188071371 CCCAAATATTTGTAAAAATATGG + Intergenic
967373904 3:188779950-188779972 TTTAAATATATATATATATGAGG + Intronic
967425985 3:189328126-189328148 CAAAAAAATATGTATATATCTGG - Intergenic
967601601 3:191396880-191396902 TTCACATATTTATATATATAAGG - Intronic
967635242 3:191793017-191793039 CACAAACATATGCACATATATGG + Intergenic
967712530 3:192725873-192725895 CTCAAATATACTTATAGACATGG + Intronic
967842298 3:194016239-194016261 CTCAAATAAATAAATAAATAAGG + Intergenic
968864662 4:3200477-3200499 CTCCATTATTTGTATATGTATGG + Intronic
969154216 4:5195942-5195964 TTCATATATATGTATGTTTAGGG - Intronic
969452890 4:7285020-7285042 AAAAAATATATATATATATATGG - Intronic
969727948 4:8935659-8935681 CTCAACTATTTGGGTATATAAGG + Intergenic
969777977 4:9373864-9373886 CACACACATATGTATGTATATGG - Intergenic
969885448 4:10211245-10211267 ATTATATATATATATATATATGG - Intergenic
969904368 4:10380298-10380320 CACACATATATATATATATTTGG + Intergenic
969946192 4:10785586-10785608 CACAAATATATGTACTGATATGG - Intergenic
969993246 4:11285588-11285610 CTTAAATATATAAATACATATGG - Intergenic
970137244 4:12938762-12938784 TATATATATATGTATATATATGG + Intergenic
970139277 4:12963147-12963169 ATTAAATATGTGTATATGTATGG + Intergenic
970168927 4:13269382-13269404 CTTAAATATATGATTTTATAGGG + Intergenic
970209550 4:13694665-13694687 ATAAAATATATATATATTTATGG + Intergenic
970280340 4:14448018-14448040 CACACATTTGTGTATATATAGGG - Intergenic
970330475 4:14977722-14977744 TGTATATATATGTATATATATGG - Intergenic
970647914 4:18144402-18144424 AAAAAATATATATATATATATGG - Intergenic
970682709 4:18529066-18529088 TTTAAACATATCTATATATATGG - Intergenic
971382802 4:26114720-26114742 CTTATGTATGTGTATATATATGG + Intergenic
971551766 4:27966238-27966260 CTCCAATATATATATATTTTTGG - Intergenic
971640426 4:29124949-29124971 CTCCAAAATATGGATATTTAAGG + Intergenic
971656237 4:29349012-29349034 TTCAAGTATATGTATATCCATGG + Intergenic
971800092 4:31278101-31278123 CACATATATCTGTATATATGAGG + Intergenic
971874933 4:32296079-32296101 TTTATATATATGTTTATATAGGG + Intergenic
971888026 4:32478217-32478239 CTCAAATATTTTTAGATAGATGG - Intergenic
971894087 4:32567942-32567964 CCCAAATATTTGTAGATACATGG - Intergenic
971976233 4:33691594-33691616 CACATATATGTATATATATATGG - Intergenic
971997733 4:33988241-33988263 GAAAAATATATGTATATATTTGG - Intergenic
972018452 4:34276948-34276970 ATCATATATATTCATATATATGG + Intergenic
972827265 4:42773788-42773810 GCCATATATACGTATATATATGG - Intergenic
973021803 4:45212081-45212103 TGTATATATATGTATATATATGG - Intergenic
973116961 4:46473475-46473497 CACACATATATGTATATATATGG - Intronic
973169232 4:47118710-47118732 CTTGAATGTATGTATATATTAGG - Intronic
973397231 4:49605657-49605679 CTCATTAATATGTATATATTCGG + Intergenic
973540395 4:51929578-51929600 AAAATATATATGTATATATATGG - Intergenic
973664523 4:53144394-53144416 TACATATACATGTATATATATGG + Intronic
974217977 4:58925289-58925311 TTCAATTATATGTCTGTATATGG - Intergenic
974241249 4:59250890-59250912 CTCTACTTTATGGATATATAAGG + Intergenic
974358588 4:60845291-60845313 TACATATATAGGTATATATAGGG + Intergenic
974466554 4:62264287-62264309 CACACATATATGTACATATATGG + Intergenic
974619671 4:64339441-64339463 TAAAAATATATATATATATATGG + Intronic
974658565 4:64857223-64857245 GACATATATATGTGTATATATGG + Intergenic
974743981 4:66045860-66045882 GTCAATTATATGTATCTATGTGG - Intergenic
974771591 4:66421750-66421772 CTGAAATACATGTATAGATGAGG - Intergenic
975040185 4:69736554-69736576 CACAAATATATATATACATATGG + Intronic
975046961 4:69817264-69817286 CACACACATATATATATATATGG - Intronic
975407584 4:74008698-74008720 CTTATATATATGAATATAAAAGG - Intergenic
975428751 4:74262219-74262241 CTGAAATATATTTGTATGTATGG - Intronic
975447213 4:74480011-74480033 CATAAATATATGCAGATATAAGG + Intergenic
975696280 4:77016655-77016677 TACACATATATATATATATATGG + Intronic
975825186 4:78312178-78312200 CATATATATATATATATATATGG - Intronic
975825187 4:78312179-78312201 CATATATATATATATATATATGG + Intronic
975876528 4:78844749-78844771 TGCACATATATGTATATATATGG + Intronic
975925490 4:79445881-79445903 CTTAAATATTTATATATTTAAGG + Intergenic
975997964 4:80337876-80337898 TACATATATATGTATATATTTGG + Intronic
976042352 4:80902337-80902359 TCCATATATATGGATATATATGG + Intronic
976239160 4:82935258-82935280 TATAAATATATATATATATATGG - Intronic
976445053 4:85120655-85120677 TTCAAATATATAATTATATAGGG + Intergenic
976691084 4:87867872-87867894 CCCAAATATATATATAGAAACGG - Intergenic
976810633 4:89096763-89096785 CATATATATATATATATATATGG - Intronic
976917262 4:90391420-90391442 CCCATATATTTATATATATAGGG - Intronic
976968475 4:91075538-91075560 TTCATATATATGTATGCATATGG - Intronic
977003763 4:91538636-91538658 CTAAAATTTATGTTTGTATAGGG - Intronic
977151439 4:93517886-93517908 CACATACATATATATATATATGG - Intronic
977195125 4:94048625-94048647 CATATATATATTTATATATATGG - Intergenic
977231992 4:94462550-94462572 CACATATATATATACATATATGG - Intronic
977476489 4:97516845-97516867 CAACAATATATATATATATATGG + Intronic
977693379 4:99940935-99940957 AAAAAATATATATATATATAGGG - Intronic
977837808 4:101665592-101665614 ATTGAATATATATATATATATGG + Intronic
978058620 4:104307448-104307470 CACACACATATATATATATATGG - Intergenic
978094970 4:104765192-104765214 CACATATTTATGTATATGTAGGG - Intergenic
978187029 4:105868297-105868319 TGTATATATATGTATATATATGG - Intronic
978210385 4:106128941-106128963 CTCAAATACATATAAATATTTGG + Intronic
978425241 4:108575379-108575401 TTCATATATATATATATAAAGGG - Intergenic
978672880 4:111272380-111272402 CTCAAATTTATTTATTTATTTGG - Intergenic
978882655 4:113725875-113725897 CAGATATATATGTATGTATATGG - Intronic
978894046 4:113864791-113864813 TACAAATATATGTATATAAAGGG + Intergenic
978939773 4:114422488-114422510 TTCAAATATATATATATATTTGG + Intergenic
978970529 4:114798725-114798747 TGCACATATATGTATATAGACGG - Intergenic
979086664 4:116419881-116419903 CTCAAATATATCTACATATTTGG - Intergenic
979816788 4:125116906-125116928 TCCATATATATGCATATATATGG + Intergenic
979816789 4:125116907-125116929 TCCATATATATGCATATATATGG - Intergenic
979849395 4:125557459-125557481 CACATATATACATATATATATGG - Intergenic
979849396 4:125557460-125557482 CATATATATATGTATATATGTGG + Intergenic
980202430 4:129673681-129673703 CACACATATATACATATATATGG + Intergenic
980242483 4:130194475-130194497 ACCAAAAATATGTATTTATATGG - Intergenic
980305572 4:131056483-131056505 CATATATATGTGTATATATAAGG - Intergenic
980561212 4:134478945-134478967 GGCAAATATATGGGTATATATGG - Intergenic
980696877 4:136368759-136368781 GTAATATATATGTATATATGTGG + Intergenic
980710959 4:136566702-136566724 CATATATATATGTATATATATGG - Intergenic
980718638 4:136662202-136662224 CACAAATAAATGAAAATATATGG + Intergenic
980942791 4:139290715-139290737 TACATATATATATATATATATGG - Intronic
981306995 4:143256905-143256927 CACAAATACATGTTTCTATATGG + Intergenic
981332229 4:143524694-143524716 CTGAAGTATATGTAAATCTAAGG + Intronic
981398656 4:144285367-144285389 CACATATATATTTTTATATATGG + Intergenic
981437496 4:144742796-144742818 CATATATATATTTATATATATGG + Exonic
981496099 4:145394823-145394845 ATAAAATATTTATATATATAAGG - Intergenic
981777773 4:148389950-148389972 CTTAAATTTGTGTATATAAAAGG - Intronic
981855017 4:149279020-149279042 CTCATATCTATGTATTTATAAGG + Intergenic
981960248 4:150528892-150528914 CTCATATAAATATATATAGAAGG - Intronic
982146351 4:152398208-152398230 ATTAAATATATTTAAATATATGG + Intronic
982151965 4:152468826-152468848 CTCAAATATACGCATCAATAGGG + Intronic
982269840 4:153575099-153575121 CTCAAATATATTTATTTATTAGG + Intronic
982507391 4:156237796-156237818 ATTATATATGTGTATATATATGG - Intergenic
982534372 4:156590824-156590846 TTGGAATATATGTATATATGTGG + Intergenic
982571544 4:157056981-157057003 CTCATACACATGTACATATAGGG + Intergenic
982704527 4:158692888-158692910 AACATATATATATATATATATGG + Intronic
982770964 4:159396964-159396986 ATCATATATATATATATAAAGGG - Intergenic
982878073 4:160672241-160672263 TACATATATATATATATATATGG - Intergenic
982933512 4:161439758-161439780 TGCAAATATATGTATATACAGGG + Intronic
982961184 4:161838702-161838724 CCAAAATATAAATATATATAGGG + Intronic
983356477 4:166665550-166665572 ATGATATATATGGATATATATGG + Intergenic
983779990 4:171657653-171657675 CACACACATATGTGTATATATGG + Intergenic
983860470 4:172699403-172699425 CACAAACACATGTATACATAAGG + Intronic
983961611 4:173761614-173761636 CTCAAGTATCTGCATATAAAAGG - Intergenic
984108910 4:175584156-175584178 CCCAAATATATGTTTAATTATGG + Intergenic
984244713 4:177261212-177261234 CTAATATATATATATATATATGG + Intergenic
984377814 4:178954239-178954261 CATAAATATATGTATGTATATGG + Intergenic
984667289 4:182442873-182442895 CACACACATATATATATATATGG + Intronic
985206575 4:187544193-187544215 CTCATATATATCTCTATATATGG - Intergenic
1202770549 4_GL000008v2_random:202085-202107 GTCATAGATATGTATGTATAGGG + Intergenic
985623554 5:970064-970086 CTTAAATATAGGTATATTAAAGG + Intergenic
985863843 5:2495913-2495935 TTAAAATATCTGTATATATCTGG + Intergenic
986043444 5:4015248-4015270 CTCATATATATATATATCTCAGG - Intergenic
986087478 5:4465653-4465675 CACATATATATATATATAAAGGG - Intergenic
986225721 5:5810293-5810315 CACATATATATATATATATGGGG - Intergenic
986225723 5:5810295-5810317 CACACATATATATATATATATGG - Intergenic
986345568 5:6832021-6832043 TGCACATATATTTATATATAGGG - Intergenic
986363673 5:7007452-7007474 CTTAAATATATTAATATTTAAGG + Intergenic
986514364 5:8545453-8545475 CCCAAATATTTTTATATAAAAGG + Intergenic
986519852 5:8603396-8603418 CTGAAATATATATGTATATTTGG + Intergenic
986842439 5:11713609-11713631 TTTATATATATGTATATATATGG - Intronic
986953267 5:13117803-13117825 TTCACCTATATATATATATATGG - Intergenic
987006276 5:13713164-13713186 CCGACATATATATATATATACGG + Intronic
987124248 5:14796551-14796573 CAAAAATATATGAATATATGGGG + Intronic
987269829 5:16295343-16295365 CACATATATATGTATATTTGTGG - Intergenic
987308366 5:16659583-16659605 GTAAAATATATAAATATATAAGG - Intergenic
987430174 5:17823186-17823208 TATAAATATATTTATATATAAGG + Intergenic
987547130 5:19325541-19325563 CACACATATATTCATATATATGG - Intergenic
987684147 5:21175097-21175119 CTCAAATATATATATATTTGAGG - Intergenic
987684148 5:21175098-21175120 CTCAAATATATATATATTTGAGG + Intergenic
987728032 5:21728264-21728286 ATATAATATATATATATATAAGG - Intergenic
987822391 5:22982253-22982275 CTAAATTTTATATATATATATGG - Intergenic
987920144 5:24269411-24269433 GCCATATATATGTTTATATATGG + Intergenic
988000942 5:25347536-25347558 CACAAATATATGTATAATTTTGG - Intergenic
988043559 5:25918349-25918371 CTCAAAACTATGTAACTATATGG + Intergenic
988072436 5:26310379-26310401 CTCACTTCTATGTATATATATGG - Intergenic
988093535 5:26571569-26571591 GTTGAATATATGTAAATATATGG + Intergenic
988095825 5:26608576-26608598 TTTTGATATATGTATATATATGG + Intergenic
988109759 5:26803900-26803922 CTCACACATATGTATATACATGG - Intergenic
988164884 5:27574785-27574807 GGCATATATATATATATATATGG - Intergenic
988170241 5:27643712-27643734 GTCAAATATAAGTAAAGATAGGG + Intergenic
988288823 5:29258056-29258078 CAGACATATATATATATATATGG + Intergenic
988291383 5:29292567-29292589 TACATATATATGTATATATATGG + Intergenic
988666365 5:33332589-33332611 CATATATATATGTATATATATGG + Intergenic
988969612 5:36453639-36453661 CTCAAATTCATGTATAATTAGGG - Intergenic
989422012 5:41251345-41251367 AGAAAATATATATATATATATGG - Intronic
989702795 5:44290683-44290705 TTCCAATATATATATATATGTGG - Intergenic
989765888 5:45082798-45082820 CAGAAATAAATCTATATATATGG - Intergenic
989775634 5:45203614-45203636 CTTATATATTTGTATATATAAGG - Intergenic
989785939 5:45329639-45329661 CTCATATACATTTATAGATATGG + Intronic
989965615 5:50463033-50463055 CTCAAATGAATGTATCTATAGGG + Intergenic
990267017 5:54087740-54087762 CTCAAATATATATATATATTTGG - Intronic
990634004 5:57702943-57702965 ATAGAATATATGTATACATATGG - Intergenic
990687620 5:58324180-58324202 CACAAACATATATACATATATGG - Intergenic
990935515 5:61144192-61144214 ATCATATATATGTACATATAAGG + Intronic
990979660 5:61591384-61591406 CTCAAATATATCTGGATATGGGG - Intergenic
991255211 5:64605838-64605860 CATAAATATATGTGTATATGTGG + Intronic
991266647 5:64727453-64727475 TTCATATATATATATATATATGG - Intronic
991628561 5:68630739-68630761 CTAAGATAAATGTATATAAAAGG + Intergenic
992271250 5:75065269-75065291 CTCAAATATAACAATATGTAGGG + Intergenic
992855681 5:80859119-80859141 CTAAAATATATATATATATATGG - Intronic
992915117 5:81442040-81442062 CACATATACATGTGTATATAGGG - Intronic
992920115 5:81506677-81506699 TTTAACTATATGTATATAAACGG + Intronic
992933143 5:81672237-81672259 TTCAATTATATGTGCATATAAGG - Intronic
993090173 5:83415968-83415990 CACACATATATATATATGTAAGG + Intergenic
993157233 5:84241169-84241191 CTCAAATGTAAGTATTTAAAAGG + Intronic
993229679 5:85218007-85218029 AAGAAATATATATATATATATGG + Intergenic
993259164 5:85637172-85637194 GTTATATATATATATATATATGG - Intergenic
993340048 5:86714268-86714290 CTCATATATGTGTATATGTGTGG - Intergenic
993356795 5:86922984-86923006 CGTTCATATATGTATATATATGG - Intergenic
993545298 5:89204355-89204377 CTCAAATATCTGTATTTCCAAGG + Intergenic
993547133 5:89226814-89226836 AAAAAATATATATATATATAAGG - Intergenic
993558976 5:89379881-89379903 CTGAAATAGATGTATACATAGGG + Intergenic
993669587 5:90743987-90744009 CTGATATATATATATACATATGG + Intronic
993671051 5:90762288-90762310 TCCAGATATATGTATATATCTGG + Intronic
993817143 5:92563626-92563648 ATTATATATATATATATATATGG + Intergenic
994314015 5:98310928-98310950 TACATGTATATGTATATATAAGG - Intergenic
994412582 5:99426762-99426784 ACCATATATATGTATATATATGG - Intergenic
994412583 5:99426788-99426810 CATATATATACGTATATATATGG - Intergenic
994412584 5:99426789-99426811 CATATATATACGTATATATATGG + Intergenic
994412585 5:99426816-99426838 CATATATATACGTATATATATGG + Intergenic
994412586 5:99426843-99426865 CATATATATACGTATATATATGG + Intergenic
994412587 5:99426870-99426892 CATATATATACGTATATATATGG + Intergenic
994412588 5:99426897-99426919 CATATATATACGTATATATATGG + Intergenic
994412589 5:99426924-99426946 CATATATATACGTATATATATGG + Intergenic
994412590 5:99426951-99426973 CATATATATACGTATATATATGG + Intergenic
994730280 5:103483374-103483396 CATATATATATATATATATATGG - Intergenic
994871699 5:105359651-105359673 CTCAAATACATATATAAAAAAGG - Intergenic
994904708 5:105824102-105824124 ATTAAATATATTTAAATATATGG + Intergenic
994909276 5:105882010-105882032 TACACATATATGTATATATAGGG + Intergenic
994919098 5:106018937-106018959 TTCAAGTACATGTTTATATAAGG - Intergenic
995170218 5:109101464-109101486 ATCAAATAAATGTATAGTTAAGG - Intronic
995171999 5:109125202-109125224 TTCTAATGTATGTATATAAAAGG - Intronic
995290605 5:110447093-110447115 TGCATATATATGTGTATATATGG - Intronic
995636473 5:114198408-114198430 CACATATATACGTATATGTATGG - Intergenic
995701879 5:114945278-114945300 CCCAAATATATATATATATTCGG - Intergenic
995756452 5:115509985-115510007 CTCATATATTTCTATATATATGG - Intergenic
995885437 5:116889064-116889086 CCCTAAAATATGTATAGATAGGG - Intergenic
995907220 5:117140067-117140089 ATTATATATATGTACATATATGG + Intergenic
996073342 5:119160134-119160156 CAGAGATATATATATATATATGG + Intronic
996106920 5:119516238-119516260 CTCATATTTATGTTTACATAAGG + Intronic
996279241 5:121708008-121708030 CTCAACTATATATATATTTATGG - Intergenic
996493355 5:124125384-124125406 TTCTGATATAAGTATATATATGG - Intergenic
996688831 5:126315363-126315385 CACAAGTATATCTGTATATAAGG - Intergenic
996948870 5:129101188-129101210 AAAAAATATATATATATATATGG + Intronic
996999566 5:129743409-129743431 CCCAAAAATATGTAAATATGTGG + Intergenic
997722616 5:136091776-136091798 TATATATATATGTATATATATGG + Intergenic
998356853 5:141545722-141545744 CTAAAATATATGTCTGTTTATGG - Intronic
998700083 5:144688288-144688310 GGCAAATATTTGTATAGATAAGG - Intergenic
999231104 5:150062245-150062267 TTAAAATATATATATATATTTGG - Intronic
999526129 5:152407972-152407994 CTGATATATATTGATATATATGG - Intronic
999840293 5:155417664-155417686 CACATATATATATATATATATGG + Intergenic
999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG + Intronic
999918968 5:156297026-156297048 TATAAATATATATATATATATGG + Intronic
1000098053 5:157988231-157988253 CACACATATACATATATATATGG - Intergenic
1000492317 5:161929382-161929404 TACACACATATGTATATATACGG + Intergenic
1000558178 5:162753125-162753147 TACATATATATATATATATATGG - Intergenic
1000752869 5:165118228-165118250 AAAAAATATATATATATATATGG + Intergenic
1000764751 5:165273114-165273136 CACAAACATATATGTATATATGG - Intergenic
1000917155 5:167096138-167096160 ATTATATATATGTATATTTATGG + Intergenic
1000928741 5:167226934-167226956 CACATATATATACATATATATGG - Intergenic
1001212876 5:169827127-169827149 CATGAATATATTTATATATATGG + Intronic
1001367306 5:171155144-171155166 TACACATATATGTATATATATGG + Intronic
1002413882 5:179107710-179107732 GTCATGTATATGTGTATATATGG - Intergenic
1002515170 5:179752346-179752368 AAAAAATATATATATATATATGG + Intronic
1002997012 6:2296502-2296524 CACACACATATGTATACATAAGG - Intergenic
1003090722 6:3100421-3100443 CTCAAATATATATATATTTCTGG + Intronic
1003252684 6:4444936-4444958 CTCAATTAAAAGTATACATATGG + Intergenic
1003431808 6:6045828-6045850 CCTATATATATATATATATATGG + Intergenic
1003585001 6:7380689-7380711 TACATATATATGTATATATGTGG - Intronic
1003711089 6:8590868-8590890 ACCATATATATATATATATATGG + Intergenic
1003711090 6:8590869-8590891 ACCATATATATATATATATATGG - Intergenic
1003760712 6:9175782-9175804 CAAAAAAATATATATATATATGG + Intergenic
1004048930 6:12054401-12054423 TTCATTTATATGTATACATATGG + Intronic
1004107994 6:12684280-12684302 TATAAATATATATATATATATGG + Intergenic
1004152101 6:13131127-13131149 TGTATATATATGTATATATATGG - Intronic
1004201950 6:13556707-13556729 CTCTAAAATATATATCTATATGG - Intergenic
1004211103 6:13645328-13645350 CTCAAATATATGTATTTCAAGGG + Intronic
1005192477 6:23241653-23241675 CTCACATCTATGTTTGTATAGGG + Intergenic
1005211691 6:23472849-23472871 ATATAATATATATATATATATGG + Intergenic
1005235846 6:23761266-23761288 CTAAAATATATATATATATTTGG + Intergenic
1005249830 6:23931792-23931814 CCCAAATATATGTATATAGTTGG - Intergenic
1005559972 6:27029838-27029860 CATAAATATATGAATATTTATGG + Intergenic
1005725502 6:28643870-28643892 AAAAAATATATATATATATATGG - Intergenic
1005741763 6:28797747-28797769 CTCAAATAAATAAATAAATATGG + Intergenic
1006528594 6:34629932-34629954 ATCATAGGTATGTATATATAGGG - Intronic
1007213792 6:40220131-40220153 CTAGAATAAATGTGTATATAAGG + Intergenic
1007685819 6:43666773-43666795 CTCAAATATATGTATATATATGG - Intronic
1007962649 6:45974389-45974411 AACAATTATATTTATATATAGGG + Intronic
1008117478 6:47568741-47568763 CTCAAATAAATAAATAAATAAGG + Intronic
1008264629 6:49409936-49409958 ATATAATATATATATATATATGG + Intergenic
1008351247 6:50492907-50492929 CCCAAATATATGCAAATATTAGG + Intergenic
1008394323 6:50989543-50989565 GTGTAATATGTGTATATATATGG - Intergenic
1008522176 6:52372731-52372753 TCCATATATATATATATATATGG + Intronic
1008522177 6:52372732-52372754 TCCATATATATATATATATATGG - Intronic
1008810047 6:55485532-55485554 CTAACATATATATGTATATATGG - Intronic
1008908096 6:56702398-56702420 CACACATATATATATACATATGG + Intronic
1009021845 6:57954900-57954922 CAAAAATATATATATATATTTGG + Intergenic
1009158004 6:60247269-60247291 CACACATATATATATATATCAGG - Intergenic
1009458091 6:63880048-63880070 CTCAAATTTACATATATTTAGGG + Intronic
1009500070 6:64401610-64401632 ATAAAATATCTGTAGATATATGG - Intronic
1009580006 6:65520604-65520626 CACACATATATGTATATATCAGG - Intronic
1009598670 6:65769613-65769635 TTTAAATATAAGTATAAATAAGG - Intergenic
1009694536 6:67084795-67084817 TTCACATCTATGTATTTATAGGG - Intergenic
1009702012 6:67196371-67196393 TGTATATATATGTATATATATGG + Intergenic
1009817049 6:68749390-68749412 CACATATATATATATATAAAGGG - Intronic
1010104674 6:72152740-72152762 TGTATATATATGTATATATATGG + Intronic
1010104675 6:72152769-72152791 TGTATATATATGTATATATATGG + Intronic
1010104676 6:72152798-72152820 TGTATATATATGTATATATATGG + Intronic
1010104678 6:72152854-72152876 TGTATATATATGTATATATATGG + Intronic
1010104679 6:72152883-72152905 TGTATATATATGTATATATATGG + Intronic
1010104680 6:72152912-72152934 TGTATATATATGTATATATATGG + Intronic
1010104681 6:72152941-72152963 TGTATATATATGTATATATATGG + Intronic
1010323894 6:74543223-74543245 CATATATATATGTATATATATGG - Intergenic
1010344620 6:74797353-74797375 GGCATATATATGTATATATAGGG - Intergenic
1010431920 6:75787643-75787665 CCCCCATATATATATATATATGG - Intronic
1010835085 6:80576259-80576281 AACAAATATATATATATATTTGG - Intergenic
1010840261 6:80641511-80641533 AGCATATATATATATATATATGG - Intergenic
1010882464 6:81195882-81195904 AAAAAATATATATATATATATGG + Intergenic
1011127215 6:84020139-84020161 AAAAAATATATATATATATATGG + Intergenic
1011265926 6:85519219-85519241 CTCAAATAAATGTATTGATTTGG + Intronic
1011423676 6:87202930-87202952 CTTAGGTATATGTATATATAGGG + Intronic
1011491291 6:87896205-87896227 CACACACATATATATATATATGG + Intergenic
1011491293 6:87896207-87896229 CACACATATATATATATATGGGG + Intergenic
1011537226 6:88389543-88389565 CTCAAATATCTGGAAATACAAGG - Intergenic
1011538012 6:88398734-88398756 GTCTCATATATATATATATATGG + Intergenic
1011837749 6:91454983-91455005 CACAAACATATGTATGTAAAAGG - Intergenic
1011898013 6:92256361-92256383 ATCATAGGTATGTATATATAAGG - Intergenic
1012159319 6:95863594-95863616 ATCAAATAGATGTAGATATGCGG + Intergenic
1012234889 6:96801932-96801954 CTTAATTATATGTATATTTAGGG - Intronic
1012295604 6:97518181-97518203 CATATATATATATATATATATGG - Intergenic
1012295605 6:97518182-97518204 CATATATATATATATATATATGG + Intergenic
1012595673 6:101035373-101035395 CACACACATATATATATATATGG - Intergenic
1012652424 6:101772309-101772331 CTGAAATATATGTTTATACCTGG + Intronic
1012652635 6:101775785-101775807 ATTATATATGTGTATATATATGG + Intronic
1012658996 6:101862427-101862449 CTTAAAAATATATAAATATAAGG - Intronic
1012755083 6:103219639-103219661 TTAAAAAATATGTTTATATAAGG + Intergenic
1013313119 6:108916129-108916151 CTTACATATATGTATACGTATGG + Intronic
1013446825 6:110237533-110237555 TACACATACATGTATATATATGG + Intronic
1013782456 6:113743862-113743884 CTAGAAAATATTTATATATAAGG - Intergenic
1013872777 6:114787224-114787246 TATATATATATGTATATATATGG + Intergenic
1013974959 6:116066417-116066439 CACACATATATATATATAAAGGG - Intergenic
1014148319 6:118023504-118023526 CTCAAATATATAAATAACTAAGG + Intronic
1014179035 6:118364495-118364517 CACACATATATATATATATACGG + Intergenic
1014223675 6:118823800-118823822 TTTAAATATATTTAAATATAAGG - Intronic
1014238127 6:118984236-118984258 TTTATATATATTTATATATATGG + Intronic
1014382131 6:120755181-120755203 CACAAAAATATATATACATATGG + Intergenic
1014461474 6:121701092-121701114 CATATATATATATATATATATGG - Intergenic
1014553420 6:122816152-122816174 ATAAAATATATTTATATATGGGG + Intergenic
1014586665 6:123205417-123205439 CATATATATATGTATGTATATGG - Intergenic
1014647984 6:123998810-123998832 CATATATATATATATATATATGG + Intronic
1015000329 6:128206172-128206194 ATCAAATCAATGAATATATAGGG + Intronic
1015201761 6:130590798-130590820 CACAAAAATATATATATATGTGG + Intergenic
1015378821 6:132543703-132543725 TTCAAAGATAAGAATATATAAGG + Intergenic
1015458394 6:133457616-133457638 CTAATATTTATGTAAATATATGG - Intronic
1015483613 6:133743463-133743485 CTAACATATATGTACATATATGG - Intergenic
1015814949 6:137199270-137199292 TTCATATATATATATATAAAGGG - Intronic
1015820497 6:137255591-137255613 CTCATATATATAAATATATATGG + Intergenic
1016031287 6:139341538-139341560 AAAAAATATATATATATATAAGG - Intergenic
1016202782 6:141432279-141432301 TATATATATATGTATATATATGG - Intergenic
1016212636 6:141558640-141558662 CTAAAATATATGTATGTTTATGG + Intergenic
1017135251 6:151142200-151142222 CATATATATATGTATATATATGG - Intergenic
1017276411 6:152574201-152574223 TACATATATATATATATATATGG + Intronic
1017362104 6:153586399-153586421 TTACAATATATGTATATACAAGG + Intergenic
1017393208 6:153964346-153964368 CCCTAATATATTTATATACATGG - Intergenic
1017605547 6:156128784-156128806 CACATATATATATATATATATGG + Intergenic
1017791833 6:157806780-157806802 CTAAACTATATATATATATTTGG + Intronic
1018168181 6:161119948-161119970 CACACACATATGTATATATCAGG - Intergenic
1018299917 6:162390428-162390450 CAAATATATATATATATATAAGG - Intronic
1018299918 6:162390429-162390451 CTTATATATATATATATATTTGG + Intronic
1018355113 6:163006213-163006235 TATATATATATGTATATATATGG + Intronic
1018545485 6:164932410-164932432 TACATATATATGTATATAAATGG + Intergenic
1019101723 6:169636021-169636043 TTCAAATATATACATATATATGG - Intronic
1020067753 7:5202380-5202402 GCCTCATATATGTATATATATGG + Intronic
1020067756 7:5202382-5202404 CTCATATATGTATATATATGGGG + Intronic
1020205843 7:6114988-6115010 CTTAAAAAAATATATATATAGGG - Intronic
1020237700 7:6369244-6369266 AAAAAAAATATGTATATATATGG + Intergenic
1020420003 7:7992125-7992147 CTCTCATATATATATATATCTGG + Intronic
1020444529 7:8255443-8255465 CTCAAATATCAGTATCTGTAAGG + Intronic
1020563432 7:9761848-9761870 ATGGAATATATGTATGTATATGG + Intergenic
1020632285 7:10653503-10653525 CTAAAATATATAAATATATTTGG + Intergenic
1020707158 7:11559495-11559517 TTTATATATATGTATATGTATGG - Intronic
1020795243 7:12671052-12671074 TCCATATATATGTGTATATATGG + Intergenic
1020813334 7:12872941-12872963 TACATATATATGTATATATAAGG + Intergenic
1020901656 7:14011002-14011024 CAAAAATATATATATATAAATGG - Intergenic
1021006786 7:15406279-15406301 CACATATGTGTGTATATATATGG + Intronic
1021006787 7:15406308-15406330 CATATATATGTGTATATATATGG + Intronic
1021006801 7:15406642-15406664 CATATATATGTGTATATATATGG + Intronic
1021006802 7:15406671-15406693 CATATATATGTGTATATATATGG + Intronic
1021074363 7:16283250-16283272 ATCATTTATATATATATATATGG - Intronic
1021227055 7:18040068-18040090 CCCAGAGATATGTATAAATAAGG - Intergenic
1021369548 7:19825563-19825585 CATAAATATATATACATATATGG - Intergenic
1021528829 7:21620127-21620149 GACAAATAATTGTATATATAGGG + Intronic
1021611803 7:22464947-22464969 CCTACATATATATATATATATGG - Intronic
1021682491 7:23148358-23148380 CTTAAATATAGGTATTTGTAAGG - Intronic
1021729540 7:23583164-23583186 ATATAATATATATATATATATGG - Intergenic
1021836359 7:24679859-24679881 CTTAAATACAAATATATATAAGG + Intronic
1022139286 7:27478991-27479013 TTCAATTATATATATATATATGG + Intergenic
1022227041 7:28373903-28373925 CATATATATATATATATATATGG - Intronic
1022511774 7:30939286-30939308 TTAAAATATATGCAAATATAGGG + Intronic
1022564211 7:31381259-31381281 CCCAGATATATGTAAATATATGG + Intergenic
1022984935 7:35643390-35643412 CTCAAATATTTGTCAATATGAGG + Intronic
1023257731 7:38328797-38328819 CATATATATATATATATATATGG + Intergenic
1023269401 7:38444979-38445001 TATATATATATGTATATATATGG - Intronic
1023430023 7:40081579-40081601 AACAAATACATGTATATAAATGG + Intronic
1023431161 7:40092683-40092705 CTCAAATATATATTTTCATATGG + Intronic
1023540543 7:41260438-41260460 CACACATATATATATGTATATGG - Intergenic
1023559431 7:41458575-41458597 TACACATATATATATATATATGG - Intergenic
1024144802 7:46503098-46503120 ATTATATATATGTATATGTATGG + Intergenic
1024162029 7:46686538-46686560 TTCAAATATATATATACAAAAGG + Intronic
1024499605 7:50090457-50090479 CACAAACATAAATATATATATGG - Intronic
1024862371 7:53860451-53860473 CTCAAAAATCTGTATATAAGTGG - Intergenic
1025263069 7:57434554-57434576 AAAAAATATATATATATATAAGG + Intergenic
1025729228 7:64095466-64095488 CTAAAAAAAATGTATATATATGG - Intronic
1026387812 7:69868010-69868032 TTCAAATATATGCCTATGTAGGG - Intronic
1026699844 7:72630770-72630792 CTGAATTATAAGTATATAAAGGG - Intronic
1027026905 7:74859370-74859392 CTCAAAAATATAAATAAATAGGG - Intergenic
1027060847 7:75084740-75084762 CTCAAAAATATAAATAAATAGGG + Intergenic
1027369228 7:77490921-77490943 TACATATATATATATATATATGG + Intergenic
1027382003 7:77621050-77621072 TTTATATATATATATATATATGG - Intronic
1027521475 7:79214472-79214494 TACATATATATGTATATATATGG + Intronic
1027685495 7:81274934-81274956 TTATTATATATGTATATATATGG - Intergenic
1027785320 7:82573210-82573232 CTCAAATAAATAAATAAATAAGG - Intergenic
1027815951 7:82971740-82971762 CATATATATATATATATATATGG - Intronic
1027821883 7:83057080-83057102 CAAAAAAATATATATATATATGG - Intronic
1027899135 7:84086660-84086682 CTCATATATATGTATATATATGG + Intronic
1027899136 7:84086679-84086701 ATGGAATATATGTATATATATGG + Intronic
1028281988 7:88941875-88941897 CTTAAATTTAAGTATATATAAGG + Intronic
1028342502 7:89738944-89738966 CACACATATATATATATATATGG - Intergenic
1028354915 7:89895361-89895383 ATAAAAAATATGTATATATAAGG + Intergenic
1028402146 7:90435334-90435356 CTCAAAACTATGTAAATACATGG + Intronic
1028667251 7:93361185-93361207 TATATATATATGTATATATATGG - Intergenic
1028702802 7:93801516-93801538 CTACTATATATATATATATATGG - Intronic
1028765895 7:94559325-94559347 TATATATATATGTATATATATGG + Intergenic
1028950902 7:96633281-96633303 TCTAAATATATATATATATAGGG + Intronic
1028982975 7:96987570-96987592 ATTAACTATATTTATATATATGG + Intergenic
1029304493 7:99608864-99608886 CACACATATATGTGTATATATGG + Intergenic
1029729207 7:102428452-102428474 CTGAAATATATGTTAATATATGG - Intergenic
1030038572 7:105429673-105429695 AACAAATATATATATATATATGG - Intergenic
1030184098 7:106743136-106743158 TACAAATATATATATATATTTGG - Intergenic
1030241349 7:107329478-107329500 ATTATATATGTGTATATATAGGG - Intronic
1030444287 7:109629575-109629597 TACAGATATATATATATATATGG - Intergenic
1030565820 7:111154358-111154380 CCTAAAAATATGTATGTATATGG - Intronic
1030814087 7:114012899-114012921 TTAAAATATATGTAGAAATATGG - Intronic
1030836363 7:114292030-114292052 CACATATATGTGTGTATATATGG + Intronic
1031109367 7:117587452-117587474 TTAAAATATGTGTATATTTATGG - Intronic
1031177014 7:118365872-118365894 CTCAAATTTATGTCTATATATGG - Intergenic
1031181017 7:118415269-118415291 ATAGTATATATGTATATATAAGG + Intergenic
1031452045 7:121934001-121934023 TTAAAAAATATGTATTTATATGG + Intronic
1031523956 7:122801152-122801174 CTCAAAAATATGTACATATAGGG + Intronic
1031640708 7:124160975-124160997 CTTAAATATATGCCTAAATATGG - Intergenic
1031811341 7:126373166-126373188 AAAAAATATATATATATATATGG - Intergenic
1032371252 7:131355448-131355470 CATATATATATGTATATATCAGG + Intronic
1032627863 7:133612148-133612170 CTCAGACATTTATATATATATGG + Intronic
1032758941 7:134919610-134919632 CTCAAATATGTCTATGTATGGGG + Intronic
1032770615 7:135051202-135051224 CTGAAAAATGTGTAAATATAAGG - Intronic
1032862734 7:135896158-135896180 ATTATATATATATATATATATGG - Intergenic
1032879991 7:136078472-136078494 GACAAATATATATATATATTTGG - Intergenic
1032988941 7:137369219-137369241 ATAAAATATCTGCATATATAAGG + Intergenic
1032998742 7:137479417-137479439 CAGAAATATATATATATATGAGG - Intronic
1033081788 7:138305761-138305783 TTCAAAAATATATATATGTACGG + Intergenic
1033083986 7:138325397-138325419 TATATATATATGTATATATATGG - Intergenic
1033094781 7:138420821-138420843 AAAAAATATATATATATATATGG + Intergenic
1034219807 7:149435169-149435191 CTCAAAAATATGTACATATATGG - Intronic
1034648980 7:152674777-152674799 TTTAAATATATATATATCTATGG + Intronic
1035874102 8:3168648-3168670 CACACAAATATATATATATATGG + Intronic
1036042352 8:5099935-5099957 TTAAAATATATATATATATAAGG + Intergenic
1036079406 8:5538212-5538234 GATAAATATATATATATATATGG - Intergenic
1036192690 8:6685264-6685286 CCCATATATATGTATATAGTTGG - Intergenic
1036275432 8:7347834-7347856 CACACACATATGTATGTATATGG - Intergenic
1036345924 8:7962524-7962546 CACACACATATGTATGTATATGG + Intergenic
1036436012 8:8734072-8734094 GATAGATATATGTATATATAGGG - Intergenic
1036541529 8:9717639-9717661 TTCAAATATCTGTTTATACAAGG + Intronic
1036841249 8:12123277-12123299 CACACACATATGTATGTATATGG + Intergenic
1036863057 8:12369529-12369551 CACACACATATGTATGTATATGG + Intergenic
1037061420 8:14514608-14514630 CTCACATATATTTATATTTCAGG + Intronic
1037217124 8:16469328-16469350 CTTAAATATATGATTGTATATGG + Intronic
1037250248 8:16884785-16884807 CTCAAATTTATAGATAAATAAGG - Intergenic
1037340714 8:17841447-17841469 CTGGAAAATATGTAAATATATGG + Intergenic
1037526730 8:19731503-19731525 CTCAAATAAATAAATAAATATGG + Intronic
1037572529 8:20170758-20170780 TGCACATATATATATATATATGG + Intronic
1037692278 8:21192000-21192022 CTTACAAATATGTATTTATATGG - Intergenic
1038064841 8:23952970-23952992 TACATATATATATATATATATGG + Intergenic
1038065317 8:23957705-23957727 GCCATATATATGTGTATATATGG + Intergenic
1038093319 8:24279130-24279152 ACCAAATATATGGACATATATGG + Intergenic
1038124678 8:24659882-24659904 TACATATATATATATATATATGG + Intergenic
1038236574 8:25763715-25763737 ATCATATATATATATATATATGG - Intergenic
1038509923 8:28123250-28123272 ATCAAATACATATATATAAAGGG - Intronic
1038532283 8:28328227-28328249 TACAAATATATATATATATCCGG - Intronic
1038597377 8:28900467-28900489 CTCAAATATCTGTTTATAATTGG + Intronic
1038929813 8:32180644-32180666 AACATATATATGTATATTTATGG + Intronic
1038984505 8:32793621-32793643 AACAAATATATATGTATATATGG + Intergenic
1039137735 8:34345359-34345381 TGCAAATATAAGTATATAGAGGG - Intergenic
1039147885 8:34470037-34470059 CACATATATATATATATATATGG + Intergenic
1039164421 8:34661191-34661213 ATCAACTGTATATATATATATGG - Intergenic
1039269439 8:35864670-35864692 TGCATATATATGTACATATATGG + Intergenic
1039574013 8:38609289-38609311 CATAAATATATATGTATATATGG - Intergenic
1039605809 8:38879524-38879546 CCCATATATATACATATATATGG + Intergenic
1039605810 8:38879525-38879547 CCCATATATATGTATATATATGG - Intergenic
1039605812 8:38879558-38879580 CACATATATATACATATATATGG + Intergenic
1039632882 8:39132272-39132294 ATCAAATATAGGTATTTATATGG + Intronic
1039760781 8:40572557-40572579 CTCAAATTTAAGTATATTAATGG + Intronic
1040602902 8:48902042-48902064 TCCATATATGTGTATATATAAGG - Intergenic
1040753010 8:50734826-50734848 CATATATATATCTATATATATGG + Intronic
1040753011 8:50734850-50734872 CATATATATATCTATATATATGG + Intronic
1040753012 8:50734874-50734896 CATATATATATCTATATATATGG + Intronic
1040825275 8:51613211-51613233 TATATATATATGTATATATATGG + Intronic
1040904388 8:52450592-52450614 CTCAAATACAGATATATAAAAGG + Intronic
1040936966 8:52791655-52791677 ATTATATATATATATATATATGG - Intergenic
1041540504 8:58979574-58979596 GGGAAATATATGTAAATATATGG + Intronic
1041558672 8:59188758-59188780 TACATATATATATATATATATGG - Intergenic
1041672058 8:60501418-60501440 CAAACATATATATATATATATGG + Intergenic
1041835725 8:62211993-62212015 ATCATATATATGGATATATCTGG + Intergenic
1041835727 8:62212029-62212051 ATCATATATATGGATATATCTGG + Intergenic
1041905980 8:63033981-63034003 GACATATATATATATATATAAGG - Intronic
1042354143 8:67807763-67807785 CACACATATATACATATATATGG - Intergenic
1042375651 8:68048535-68048557 TTCAAATATTTATATATAAAGGG - Intronic
1042380331 8:68105680-68105702 ATTATATATATATATATATATGG + Intronic
1043046686 8:75332976-75332998 CACACATATATATATATATATGG + Intergenic
1043099717 8:76027101-76027123 ATAAAAGATATGTATTTATATGG + Intergenic
1043104172 8:76087318-76087340 CTCAAATCTATATATATACATGG - Intergenic
1043110915 8:76180388-76180410 TATATATATATGTATATATATGG + Intergenic
1043193784 8:77263877-77263899 CTCAAATATATATAAATATATGG + Intergenic
1043196521 8:77299728-77299750 CATATATATGTGTATATATATGG - Intergenic
1043270060 8:78322068-78322090 TTCATATATATATATATATATGG - Intergenic
1043330325 8:79109360-79109382 ATTATATATATATATATATATGG + Intergenic
1043330519 8:79111790-79111812 TTTAAAAATATGTATATATTAGG - Intergenic
1043509900 8:80940007-80940029 ATGAAATATATATATATATTTGG + Intergenic
1043752542 8:83957388-83957410 TACATATATATGTATATATAAGG + Intergenic
1043843823 8:85141339-85141361 CACATATATATGTGTATATGTGG - Intronic
1044465469 8:92498725-92498747 CACATATATATGTATACATACGG + Intergenic
1044796515 8:95904826-95904848 CTCAACTTTATGTATATGTTAGG + Intergenic
1044867216 8:96583658-96583680 TTCAAATACATATATATATTTGG - Intronic
1045310481 8:100997282-100997304 TTTTAATATATGTATATATTTGG - Intergenic
1045512843 8:102826922-102826944 ATTAAAAATATATATATATAGGG - Exonic
1045699957 8:104854587-104854609 TTCAAATATATGGAAATTTATGG - Intronic
1045769623 8:105720742-105720764 CTAAAATAGATATATAGATAAGG + Intronic
1045812592 8:106240497-106240519 CACACACATATATATATATATGG + Intergenic
1045847309 8:106653079-106653101 AAAAAATATATATATATATATGG + Intronic
1046230781 8:111353805-111353827 CTCAAAAATATGTTTAAAGATGG + Intergenic
1046266981 8:111843475-111843497 TTTAAAAATATGTATGTATATGG + Intergenic
1046317546 8:112525740-112525762 TATATATATATGTATATATATGG - Intronic
1046344064 8:112899812-112899834 TATATATATATGTATATATATGG + Intronic
1046371545 8:113315570-113315592 TTCAAATATATATATATATCAGG + Intronic
1046424167 8:114024553-114024575 CACAAATGTATGTATGTGTATGG - Intergenic
1046469743 8:114655338-114655360 CATATATATGTGTATATATATGG - Intergenic
1046567403 8:115919040-115919062 CTCAAATAAATTGAGATATATGG + Intergenic
1046572090 8:115979125-115979147 GTCAAATATATGATAATATAAGG - Intergenic
1046578812 8:116066584-116066606 CTCAAATATATATAGAAGTATGG - Intergenic
1047658188 8:127002061-127002083 CTCTCATATATATATATATTTGG + Intergenic
1047828055 8:128599865-128599887 CTCCAAGATATGTCTGTATAAGG + Intergenic
1047908355 8:129497719-129497741 ATGGAATATATATATATATATGG - Intergenic
1048042919 8:130748304-130748326 CACATATATATATATATAAAGGG + Intergenic
1048608358 8:135994127-135994149 CATATATATATATATATATATGG - Intergenic
1048753985 8:137714124-137714146 ATGAAATATATATATATAAATGG + Intergenic
1048828174 8:138449899-138449921 ATAATATTTATGTATATATAGGG - Intronic
1048835816 8:138517856-138517878 CACACACATATATATATATAGGG + Intergenic
1048945413 8:139442660-139442682 TACATATATATATATATATATGG + Intergenic
1049131369 8:140846341-140846363 TACATTTATATGTATATATAAGG + Intronic
1049331097 8:142053294-142053316 GCCATATATATATATATATATGG + Intergenic
1049331098 8:142053295-142053317 GCCATATATATATATATATATGG - Intergenic
1050055547 9:1649456-1649478 CTTAAATACATGTATATGTAGGG + Intergenic
1050121256 9:2310190-2310212 CTCAAAAAACTGTATATAGAAGG - Intergenic
1050620173 9:7443953-7443975 CTCTAAAATATGAATATATTTGG - Intergenic
1050782291 9:9352309-9352331 CACATATATATATATATATATGG - Intronic
1050786483 9:9409805-9409827 CTAAAATATGAGTTTATATATGG - Intronic
1050840758 9:10146149-10146171 TACATATATATATATATATATGG - Intronic
1050924643 9:11248684-11248706 ATCAAATAGTTGTAGATATACGG - Intergenic
1050960655 9:11725914-11725936 ATAAAAAATATATATATATATGG - Intergenic
1051003883 9:12318268-12318290 GAGAAATATATATATATATATGG - Intergenic
1051009000 9:12387097-12387119 TTAAAATATATATATATATTGGG + Intergenic
1051392364 9:16579722-16579744 CACACATATGTGCATATATATGG + Intronic
1051497547 9:17741337-17741359 CTAAAATACATGTATTTAGACGG + Intronic
1051543475 9:18247868-18247890 GGTATATATATGTATATATATGG + Intergenic
1051828470 9:21248644-21248666 CTCAAAAATAGATATAGATATGG + Intergenic
1051930806 9:22383084-22383106 TTCTCATATATATATATATATGG - Intergenic
1052245967 9:26335470-26335492 TATATATATATGTATATATATGG - Intergenic
1052306691 9:27018165-27018187 TTCAGATATATATATGTATATGG + Intronic
1052422218 9:28257889-28257911 CTCCAATATAAGTACATAAAAGG - Intronic
1052463007 9:28790810-28790832 TTCAAAGGTATGTATGTATAGGG + Intergenic
1052937928 9:34108983-34109005 TTTATATATATATATATATATGG + Intronic
1053261546 9:36670198-36670220 CTCAATAATGTGTATATATGTGG + Intronic
1053261765 9:36672392-36672414 CTCAATAATGTGTATATATGTGG - Intronic
1053578775 9:39381276-39381298 ATAAAATATATATTTATATATGG + Intergenic
1054100358 9:60940080-60940102 ATAAAATATATATTTATATATGG + Intergenic
1054121756 9:61215706-61215728 ATAAAATATATATTTATATATGG + Intergenic
1054358603 9:64089816-64089838 GTCATAGATATGTATGTATAGGG - Intergenic
1054585987 9:66966805-66966827 ATAAAATATATATTTATATATGG - Intergenic
1054768905 9:69066865-69066887 AAAAAATATATATATATATATGG + Intronic
1054840767 9:69736653-69736675 CCCATATATATCCATATATAAGG + Intronic
1054840768 9:69736654-69736676 CCCTTATATATGGATATATATGG - Intronic
1055690962 9:78830241-78830263 CACACATATATGTGAATATATGG - Intergenic
1055713145 9:79087643-79087665 ATATAATATATATATATATAAGG + Intergenic
1055737298 9:79344696-79344718 CATATATATATATATATATATGG - Intergenic
1055821833 9:80274590-80274612 GTCTTATATATGCATATATATGG - Intergenic
1056170763 9:83981714-83981736 CTAAAATATATGCATGTATTCGG - Intronic
1056947053 9:91006515-91006537 CTTAAATTTGTGTATATTTAAGG - Intergenic
1057530976 9:95846259-95846281 CAGAAATATATGTGTATGTATGG - Intergenic
1057959817 9:99444302-99444324 CCAAAAAATATATATATATATGG - Intergenic
1058233308 9:102458649-102458671 GTAAAATTTATGTATATTTATGG - Intergenic
1058261574 9:102839769-102839791 CACACATATATATATAAATAAGG + Intergenic
1058289162 9:103215613-103215635 TTCAAATGTTTGTATATATGTGG - Intergenic
1058316357 9:103571145-103571167 ATAAAATATATACATATATACGG + Intergenic
1058789740 9:108431310-108431332 TTAAAATAAATATATATATATGG + Intergenic
1058876457 9:109249080-109249102 TATATATATATGTATATATATGG + Intronic
1059059877 9:111024507-111024529 ATTATATATATTTATATATATGG + Intronic
1059095180 9:111405746-111405768 CTCAAAAAAAGGTATATAAATGG + Intronic
1059243869 9:112832871-112832893 ATAAAATATCTATATATATAAGG + Intronic
1059598595 9:115750700-115750722 ATCACATTTGTGTATATATACGG + Intergenic
1059627764 9:116085782-116085804 CATAAACATATATATATATATGG - Intergenic
1059839588 9:118198232-118198254 CATAAATATATCCATATATATGG - Intergenic
1060541997 9:124437425-124437447 CACATATATATGGATATATATGG - Intergenic
1060874449 9:127071111-127071133 AACATATATATATATATATATGG + Intronic
1061270989 9:129542416-129542438 AAAAAATATATATATATATATGG - Intergenic
1203704100 Un_KI270742v1:21661-21683 CTCATAGATATGTATGTATAGGG - Intergenic
1203559902 Un_KI270744v1:44160-44182 CTCATAGATATGTATGTATAGGG + Intergenic
1185484294 X:470541-470563 AAAAAATATATATATATATATGG + Intergenic
1185700138 X:2224687-2224709 CACAAATATATATACACATATGG + Intronic
1185826114 X:3252230-3252252 CTACATTATATGTGTATATATGG + Intergenic
1186088518 X:6018215-6018237 CGCATATATGTGTATATATGTGG - Intronic
1186116127 X:6306798-6306820 CTCAAATAAATAAATAAATAAGG + Intergenic
1186234548 X:7493570-7493592 CACATATATATGTATTTTTATGG + Intergenic
1186243577 X:7596250-7596272 CACACATATATGAATATATATGG + Intergenic
1186343619 X:8668434-8668456 CACACATACATATATATATATGG + Intronic
1186343624 X:8668525-8668547 ATCATATATATATATATATATGG - Intronic
1186769980 X:12808160-12808182 ATCAAAAATAGGTATATATGGGG - Intronic
1186821565 X:13293218-13293240 CTCATATATATATACACATATGG - Intergenic
1187242790 X:17528792-17528814 CTCAAATATTTATAAATATATGG + Intronic
1187252907 X:17615257-17615279 TACACATATATATATATATATGG + Intronic
1187486656 X:19710663-19710685 CTCATAGATATGTACGTATAGGG + Intronic
1188053820 X:25518477-25518499 CTCAAATACATATATATGTATGG + Intergenic
1188140556 X:26545266-26545288 ATTAAATATATGTATATAAAGGG - Intergenic
1188145053 X:26601785-26601807 TGAAAATATATATATATATATGG - Intergenic
1188208858 X:27394348-27394370 TACAAATATATATATATATCCGG - Intergenic
1188231856 X:27673618-27673640 TACATATATATGTATATATAAGG - Intronic
1188241334 X:27795306-27795328 CCCATATATATTTTTATATATGG - Intergenic
1188275566 X:28196424-28196446 CTTAAATACATGTCTAAATATGG - Intergenic
1188317324 X:28690591-28690613 ATTGGATATATGTATATATACGG - Intronic
1188384284 X:29536761-29536783 TTTAAATATATATATATATATGG + Intronic
1188546206 X:31310205-31310227 CATATATATATATATATATATGG - Intronic
1188911800 X:35858075-35858097 CCCAAATTTAAGTATATTTAGGG - Intergenic
1189057638 X:37715042-37715064 TACACATATATGTATATATTTGG - Intronic
1189057640 X:37715120-37715142 CACACATATTTGTATATATTTGG - Intronic
1189113247 X:38315809-38315831 TATATATATATGTATATATATGG - Intronic
1189666647 X:43362256-43362278 TATACATATATGTATATATATGG - Intergenic
1190125343 X:47699882-47699904 ATCATAGATATGTATATGTAGGG - Intergenic
1190399251 X:50015037-50015059 CCTACCTATATGTATATATATGG + Intronic
1190518535 X:51250988-51251010 GTAGTATATATGTATATATAAGG + Intergenic
1190753998 X:53384988-53385010 AAAAAATATATATATATATATGG + Intronic
1191744476 X:64470959-64470981 GACAAAAATATGTATATTTATGG + Intergenic
1192193918 X:69016127-69016149 CTTAAATATATATATTTAAAGGG - Intergenic
1192427230 X:71088112-71088134 GACATATATATATATATATATGG + Intergenic
1192629838 X:72768796-72768818 CACAAATATATGAATATATTTGG + Intergenic
1192651872 X:72952008-72952030 CACAAATATATGAATATATTTGG - Intergenic
1192903916 X:75529193-75529215 TGCATATATATATATATATATGG + Intergenic
1193041562 X:77009226-77009248 CTCAAATCTATGTATCCAGATGG + Intergenic
1193452066 X:81683791-81683813 ATCAAATATATTTATGCATATGG - Intergenic
1193660705 X:84254055-84254077 CTTAAATATATGAAAATATCAGG + Intergenic
1193741485 X:85222497-85222519 TTCAAATATATATGTATATTGGG - Intergenic
1193792998 X:85839605-85839627 TTCAGATTTATGTATATGTATGG - Intergenic
1193876814 X:86871033-86871055 CCCATATATAAATATATATATGG + Intergenic
1193903361 X:87211451-87211473 ATCACATAAATATATATATATGG + Intergenic
1194078387 X:89426696-89426718 TACATATATAAGTATATATATGG + Intergenic
1194078771 X:89431998-89432020 AAAAAATATATATATATATATGG - Intergenic
1194174972 X:90633913-90633935 ATTATATATATCTATATATAAGG + Intergenic
1194584452 X:95715814-95715836 TACATATATATGTATATATATGG + Intergenic
1194782565 X:98043300-98043322 TTTACATATATGTGTATATATGG - Intergenic
1194815439 X:98435517-98435539 AGCTAATTTATGTATATATATGG + Intergenic
1194898303 X:99472765-99472787 CTAAATTATACATATATATATGG - Intergenic
1195294631 X:103463860-103463882 AAAAAATATATATATATATATGG - Intergenic
1195304271 X:103563775-103563797 CACAGATATATATATATATATGG + Intergenic
1195424447 X:104712570-104712592 CTCAAATGTATATTTATTTAAGG - Intronic
1195498180 X:105562478-105562500 CACAAATAATTGTATATATGGGG - Intronic
1195576123 X:106452571-106452593 TACATATATATGTATGTATATGG - Intergenic
1195731505 X:107972975-107972997 AAAAAATATATATATATATATGG + Intergenic
1196006842 X:110845601-110845623 GTCAAAGATATGTAGATATATGG + Intergenic
1196083105 X:111654773-111654795 TGTATATATATGTATATATATGG + Intergenic
1196084141 X:111665995-111666017 CCTATATATATATATATATAGGG - Intronic
1196226450 X:113172888-113172910 TACATATATATGTATATATATGG + Intergenic
1196351794 X:114740174-114740196 CACATTTATATATATATATATGG + Intronic
1196384893 X:115138807-115138829 TTCAAATCTATGTATATATTAGG - Intronic
1196541470 X:116914607-116914629 TATACATATATGTATATATATGG + Intergenic
1197016318 X:121630901-121630923 TATAGATATATGTATATATATGG + Intergenic
1197108240 X:122741857-122741879 ATGAAATATATAAATATATATGG + Intergenic
1197536881 X:127701040-127701062 CTCAAAAAAATCTATATAAAAGG + Intergenic
1197541709 X:127771252-127771274 CTCAAATAAAGGTAGATTTAGGG + Intergenic
1197544275 X:127804735-127804757 TCCATATATATGCATATATATGG + Intergenic
1197544276 X:127804736-127804758 CCCATATATATGCATATATATGG - Intergenic
1198025358 X:132700533-132700555 CATATATATATATATATATATGG + Intronic
1198335357 X:135660676-135660698 CTTGAATTTATGTTTATATAAGG + Intergenic
1198343305 X:135735666-135735688 CACACATACATATATATATATGG - Intergenic
1198444192 X:136694824-136694846 TTCAAATATATGCAAATATGGGG + Intronic
1198471700 X:136952887-136952909 TGTATATATATGTATATATATGG + Intergenic
1198513073 X:137373823-137373845 TTTATATATATATATATATATGG - Intergenic
1198588731 X:138151921-138151943 CACACATATATATACATATATGG + Intergenic
1198710945 X:139503196-139503218 TGGATATATATGTATATATATGG - Intergenic
1198834517 X:140788757-140788779 TACACATATATGTGTATATATGG - Intergenic
1198925668 X:141791584-141791606 TACAAATTTATGTATATAAAAGG + Intergenic
1199010817 X:142756388-142756410 CTCATATATCTATATCTATATGG + Intergenic
1199102084 X:143814268-143814290 TTTATATATATATATATATATGG - Intergenic
1199240594 X:145543808-145543830 GTGATATATATGAATATATATGG + Intergenic
1199316843 X:146389227-146389249 ATCAATTATAAGAATATATAAGG - Intergenic
1199438560 X:147842311-147842333 ATATAATATATATATATATATGG - Intergenic
1199726134 X:150584031-150584053 AGCAAATATATTTTTATATATGG + Intronic
1199865914 X:151849808-151849830 TTCAAATAAATTTTTATATATGG - Intergenic
1199901908 X:152182814-152182836 ACTATATATATGTATATATATGG - Intronic
1200315224 X:155125330-155125352 CTCTGAGATATATATATATAGGG - Intronic
1200328947 X:155273936-155273958 CTCAAAAAAATATATACATATGG + Intergenic
1200373686 X:155756483-155756505 TTCAAATATATCTTTATATATGG - Intergenic
1200431028 Y:3082234-3082256 TACATATATAAGTATATATATGG + Intergenic
1200431029 Y:3082276-3082298 TACATATATAAGTATATATATGG + Intergenic
1200431030 Y:3082318-3082340 TACATATATAAGTATATATATGG + Intergenic
1200431032 Y:3082400-3082422 TACATATATAAGTATATATATGG + Intergenic
1200565886 Y:4766559-4766581 CAAATATATATATATATATATGG + Intergenic
1200615520 Y:5374466-5374488 TATATATATATGTATATATATGG + Intronic
1200965556 Y:9033409-9033431 TGTATATATATGTATATATATGG + Intergenic
1201072522 Y:10161369-10161391 ATCAGATATTTGTATATATGTGG + Intergenic
1201259603 Y:12145906-12145928 TATATATATATGTATATATATGG - Intergenic
1201392203 Y:13510896-13510918 CTCAAAAAAAAATATATATATGG + Intergenic
1201458425 Y:14196253-14196275 CATATATATATGTATGTATATGG - Intergenic
1201480946 Y:14438921-14438943 ATGGAATATATGTATATATAAGG + Intergenic
1201488919 Y:14520988-14521010 GACATATATATGTAGATATATGG - Intergenic
1201641633 Y:16184486-16184508 CACACAAATATGTGTATATATGG - Intergenic
1201661182 Y:16400836-16400858 CACACAAATATGTGTATATATGG + Intergenic
1201677001 Y:16597213-16597235 CACATATATATGTATATATCCGG + Intergenic
1201692419 Y:16781555-16781577 CTCTAATCTATGTATCTATCTGG + Intergenic