ID: 1007686089

View in Genome Browser
Species Human (GRCh38)
Location 6:43668146-43668168
Sequence GGAAAAGCCCCCTGCAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007686089_1007686091 -9 Left 1007686089 6:43668146-43668168 CCAAGTCTGCAGGGGGCTTTTCC No data
Right 1007686091 6:43668160-43668182 GGCTTTTCCCCGAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1007686089_1007686098 11 Left 1007686089 6:43668146-43668168 CCAAGTCTGCAGGGGGCTTTTCC No data
Right 1007686098 6:43668180-43668202 AGGCGGTGACAGCAGCTGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 438
1007686089_1007686099 12 Left 1007686089 6:43668146-43668168 CCAAGTCTGCAGGGGGCTTTTCC No data
Right 1007686099 6:43668181-43668203 GGCGGTGACAGCAGCTGGCTGGG No data
1007686089_1007686092 -6 Left 1007686089 6:43668146-43668168 CCAAGTCTGCAGGGGGCTTTTCC No data
Right 1007686092 6:43668163-43668185 TTTTCCCCGAGTCCTGGAGGCGG 0: 1
1: 0
2: 1
3: 16
4: 183
1007686089_1007686097 7 Left 1007686089 6:43668146-43668168 CCAAGTCTGCAGGGGGCTTTTCC No data
Right 1007686097 6:43668176-43668198 CTGGAGGCGGTGACAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007686089 Original CRISPR GGAAAAGCCCCCTGCAGACT TGG (reversed) Intronic