ID: 1007686090

View in Genome Browser
Species Human (GRCh38)
Location 6:43668157-43668179
Sequence GGGGGCTTTTCCCCGAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007686085_1007686090 -3 Left 1007686085 6:43668137-43668159 CCTGCAGCACCAAGTCTGCAGGG No data
Right 1007686090 6:43668157-43668179 GGGGGCTTTTCCCCGAGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007686090 Original CRISPR GGGGGCTTTTCCCCGAGTCC TGG Intronic